ID: 987685344

View in Genome Browser
Species Human (GRCh38)
Location 5:21192018-21192040
Sequence CAATATATAAAGGTGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987685344_987685346 -6 Left 987685344 5:21192018-21192040 CCAAACTGCACCTTTATATATTG No data
Right 987685346 5:21192035-21192057 ATATTGTGTATCAATTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987685344 Original CRISPR CAATATATAAAGGTGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr