ID: 987686950

View in Genome Browser
Species Human (GRCh38)
Location 5:21217092-21217114
Sequence TGAGCCTGAGTAAAAGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987686950_987686952 9 Left 987686950 5:21217092-21217114 CCTAATTCTTTTACTCAGGCTCA No data
Right 987686952 5:21217124-21217146 TTTGCAGTATTTCATATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987686950 Original CRISPR TGAGCCTGAGTAAAAGAATT AGG (reversed) Intergenic