ID: 987690430

View in Genome Browser
Species Human (GRCh38)
Location 5:21259400-21259422
Sequence GCTTAAGTGTAGTCACCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987690430_987690434 11 Left 987690430 5:21259400-21259422 CCAAGTGGTGACTACACTTAAGC No data
Right 987690434 5:21259434-21259456 TGAGTCTACCAGTTTAATACTGG No data
987690430_987690435 16 Left 987690430 5:21259400-21259422 CCAAGTGGTGACTACACTTAAGC No data
Right 987690435 5:21259439-21259461 CTACCAGTTTAATACTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987690430 Original CRISPR GCTTAAGTGTAGTCACCACT TGG (reversed) Intergenic
No off target data available for this crispr