ID: 987691667

View in Genome Browser
Species Human (GRCh38)
Location 5:21274847-21274869
Sequence CTGAATACACTAACAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987691667_987691668 -5 Left 987691667 5:21274847-21274869 CCATTGTCTGTTAGTGTATTCAG No data
Right 987691668 5:21274865-21274887 TTCAGTCTCCCATAGTATAAAGG No data
987691667_987691671 11 Left 987691667 5:21274847-21274869 CCATTGTCTGTTAGTGTATTCAG No data
Right 987691671 5:21274881-21274903 ATAAAGGCCGAAACTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987691667 Original CRISPR CTGAATACACTAACAGACAA TGG (reversed) Intergenic
No off target data available for this crispr