ID: 987692268

View in Genome Browser
Species Human (GRCh38)
Location 5:21282605-21282627
Sequence CTGAATGCAAAGATGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987692268_987692272 4 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692272 5:21282632-21282654 AACTGGTTCATGGTTCATACTGG No data
987692268_987692273 5 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692273 5:21282633-21282655 ACTGGTTCATGGTTCATACTGGG No data
987692268_987692279 26 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692279 5:21282654-21282676 GGGGAACAAGGTCCATGGTTGGG No data
987692268_987692276 14 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692276 5:21282642-21282664 TGGTTCATACTGGGGGAACAAGG No data
987692268_987692278 25 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692278 5:21282653-21282675 GGGGGAACAAGGTCCATGGTTGG No data
987692268_987692271 -6 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692271 5:21282622-21282644 ATTCAGATTCAACTGGTTCATGG No data
987692268_987692277 21 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692277 5:21282649-21282671 TACTGGGGGAACAAGGTCCATGG No data
987692268_987692274 6 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692274 5:21282634-21282656 CTGGTTCATGGTTCATACTGGGG No data
987692268_987692275 7 Left 987692268 5:21282605-21282627 CCTCATTCCATCTTTGCATTCAG No data
Right 987692275 5:21282635-21282657 TGGTTCATGGTTCATACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987692268 Original CRISPR CTGAATGCAAAGATGGAATG AGG (reversed) Intergenic
No off target data available for this crispr