ID: 987693309

View in Genome Browser
Species Human (GRCh38)
Location 5:21296602-21296624
Sequence ACATTTTTACTGATGGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987693309_987693313 11 Left 987693309 5:21296602-21296624 CCTTTCGCCATCAGTAAAAATGT No data
Right 987693313 5:21296636-21296658 TAGCTGGACACATGATCACCAGG No data
987693309_987693311 -5 Left 987693309 5:21296602-21296624 CCTTTCGCCATCAGTAAAAATGT No data
Right 987693311 5:21296620-21296642 AATGTCCTCTAATGCTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987693309 Original CRISPR ACATTTTTACTGATGGCGAA AGG (reversed) Intergenic
No off target data available for this crispr