ID: 987694490

View in Genome Browser
Species Human (GRCh38)
Location 5:21310560-21310582
Sequence GTGAAGAATAGGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987694490_987694496 9 Left 987694490 5:21310560-21310582 CCTCCCCCTTTCCTATTCTTCAC No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987694490 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr