ID: 987694496

View in Genome Browser
Species Human (GRCh38)
Location 5:21310592-21310614
Sequence AGCAAAGCTCATAGAATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987694490_987694496 9 Left 987694490 5:21310560-21310582 CCTCCCCCTTTCCTATTCTTCAC No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data
987694491_987694496 6 Left 987694491 5:21310563-21310585 CCCCCTTTCCTATTCTTCACTAT No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data
987694492_987694496 5 Left 987694492 5:21310564-21310586 CCCCTTTCCTATTCTTCACTATT No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data
987694493_987694496 4 Left 987694493 5:21310565-21310587 CCCTTTCCTATTCTTCACTATTT No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data
987694494_987694496 3 Left 987694494 5:21310566-21310588 CCTTTCCTATTCTTCACTATTTT No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data
987694495_987694496 -2 Left 987694495 5:21310571-21310593 CCTATTCTTCACTATTTTGATAG No data
Right 987694496 5:21310592-21310614 AGCAAAGCTCATAGAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987694496 Original CRISPR AGCAAAGCTCATAGAATTAG AGG Intergenic
No off target data available for this crispr