ID: 987695731

View in Genome Browser
Species Human (GRCh38)
Location 5:21328957-21328979
Sequence CAGTAAAGATGGAGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987695728_987695731 9 Left 987695728 5:21328925-21328947 CCAGAAATGACAGCAACAACAAA No data
Right 987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG No data
987695727_987695731 16 Left 987695727 5:21328918-21328940 CCAACAACCAGAAATGACAGCAA No data
Right 987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987695731 Original CRISPR CAGTAAAGATGGAGAGAAAT AGG Intergenic
No off target data available for this crispr