ID: 987714867

View in Genome Browser
Species Human (GRCh38)
Location 5:21554904-21554926
Sequence TCCATGTGTTGAAGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987714865_987714867 8 Left 987714865 5:21554873-21554895 CCATAAAGCAAAGGAAAATTTGT No data
Right 987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987714867 Original CRISPR TCCATGTGTTGAAGGAGTGC TGG Intergenic
No off target data available for this crispr