ID: 987720594

View in Genome Browser
Species Human (GRCh38)
Location 5:21627892-21627914
Sequence CTGTTACTCACTTGGAAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987720594_987720598 0 Left 987720594 5:21627892-21627914 CCGCCTTTCCAAGTGAGTAACAG No data
Right 987720598 5:21627915-21627937 TTCTCTCTTGCTGGCATCCCAGG No data
987720594_987720599 9 Left 987720594 5:21627892-21627914 CCGCCTTTCCAAGTGAGTAACAG No data
Right 987720599 5:21627924-21627946 GCTGGCATCCCAGGTGCCACTGG No data
987720594_987720597 -9 Left 987720594 5:21627892-21627914 CCGCCTTTCCAAGTGAGTAACAG No data
Right 987720597 5:21627906-21627928 GAGTAACAGTTCTCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987720594 Original CRISPR CTGTTACTCACTTGGAAAGG CGG (reversed) Intergenic
No off target data available for this crispr