ID: 987732134

View in Genome Browser
Species Human (GRCh38)
Location 5:21787351-21787373
Sequence GTAATCTTGTTTGCTGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987732134_987732136 -10 Left 987732134 5:21787351-21787373 CCTCTACCAGCAAACAAGATTAC 0: 1
1: 0
2: 10
3: 32
4: 145
Right 987732136 5:21787364-21787386 ACAAGATTACAACTTGCTGAAGG 0: 1
1: 46
2: 128
3: 336
4: 578
987732134_987732137 -4 Left 987732134 5:21787351-21787373 CCTCTACCAGCAAACAAGATTAC 0: 1
1: 0
2: 10
3: 32
4: 145
Right 987732137 5:21787370-21787392 TTACAACTTGCTGAAGGCTCAGG 0: 4
1: 11
2: 38
3: 54
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987732134 Original CRISPR GTAATCTTGTTTGCTGGTAG AGG (reversed) Intronic
902182822 1:14702468-14702490 TTCATCTTGTTTGGTGGTGGAGG - Intronic
902526578 1:17062432-17062454 GACATCTTGCTTGCAGGTAGAGG + Intergenic
905012680 1:34758034-34758056 GTCGTCTTGTTTGCAGGAAGAGG - Exonic
910631544 1:89360499-89360521 ATATTCTTGTTTGCAGGTAGGGG - Intergenic
911114635 1:94234062-94234084 CTACTCTGGTTTGATGGTAGTGG - Intronic
911968365 1:104397153-104397175 GTAATCTTTATTGCTGGTGGAGG + Intergenic
915659531 1:157391024-157391046 GTAATCTTGCATGTTGGTGGGGG + Intergenic
916744731 1:167676344-167676366 CTCATCTTGTTTTCTGGCAGTGG - Intronic
916958501 1:169865361-169865383 GTAAACCTGTTTGCTGATAGCGG - Intronic
917136122 1:171789678-171789700 GTAATCTTTTCTCCTGTTAGTGG + Intronic
918411718 1:184265854-184265876 GTAATCTTTTTTGCTGGTGAAGG - Intergenic
919438616 1:197597325-197597347 GTAATCTTTTTTGGGGGTGGAGG - Intronic
921226139 1:213021644-213021666 ATAATATTTTTTGCTGGTGGAGG - Intergenic
921829102 1:219707236-219707258 GTAATCTTTTTTGCTGATGGAGG - Intronic
922065353 1:222133299-222133321 ATAATCTTCTTTGCTGGTGGAGG + Intergenic
1062783142 10:235412-235434 ATAATCTTTTTTTCTGGTGGGGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069565513 10:69460978-69461000 GTTTTCTTGTCTGCTGGGAGGGG + Intronic
1071226041 10:83528865-83528887 GTCATATTCTTTGCTGGTGGAGG + Intergenic
1073598860 10:104826615-104826637 ATCATCTTTTTTGCTGGTAGAGG + Intronic
1074103220 10:110369909-110369931 GTATTCCTGGTTGCTGGTCGGGG + Intergenic
1075263715 10:120983745-120983767 GGAAACTTGTTTGCTGTTTGGGG - Intergenic
1076617957 10:131769287-131769309 GTAATATTATTTGATGCTAGAGG + Intergenic
1078209698 11:9260648-9260670 TTAATTTTGTTTTCTGGTTGAGG - Intronic
1078951142 11:16135975-16135997 ATAATCTTTTTTACTGGTGGAGG - Intronic
1080884922 11:36358409-36358431 GTAATCTTTTTTGCTGGTGGAGG - Intronic
1080902075 11:36504082-36504104 ATAATATTTTTTGCTGGTAGAGG + Intronic
1082187286 11:49199379-49199401 GCAATCTTGTTTGCAAGTTGGGG - Intronic
1085504378 11:77048757-77048779 ATAATCCTGTTTTCTGGTTGCGG - Intergenic
1085680113 11:78565441-78565463 GTAAGCTGGTCTACTGGTAGGGG - Intronic
1086679050 11:89646045-89646067 GCAATCTTGTTTGCAAGTTGGGG + Intergenic
1087025767 11:93648153-93648175 GTAAACATGGCTGCTGGTAGAGG - Intergenic
1088157056 11:106819519-106819541 ATAATCTTTTTTGCTGGTGGAGG - Intronic
1088387646 11:109276777-109276799 GAAATCTTGTATGCTGTTGGTGG - Intergenic
1089415562 11:118286708-118286730 ATAATCTTTTTTGCTGGTGGTGG - Intergenic
1089424950 11:118365215-118365237 GTCATCTTATTTGCTGCTATTGG - Intronic
1091273908 11:134337322-134337344 GGACTCCTGTTTGCTGGGAGAGG - Intronic
1094754114 12:33446553-33446575 GTAGTCTTTTTTGCTGGTAGAGG + Intergenic
1095254939 12:40023436-40023458 GTACACTTGTTCGCTGGTACAGG + Intronic
1096714318 12:53482248-53482270 GCATTCTTGTTTTCTGCTAGGGG - Intronic
1098214102 12:68197697-68197719 GTAATTTTGTTTGCTGCTTGAGG - Intergenic
1101685273 12:107013307-107013329 ATAATCTTTTTTGCTGGTGGAGG - Intronic
1105429029 13:20320306-20320328 GTGTTCTTGTTTGCTGTGAGAGG - Intergenic
1108149372 13:47516688-47516710 GTAATGTTGTTTGCTGGACAAGG + Intergenic
1109927427 13:69162556-69162578 AGAATCTTTTTTGCTGATAGAGG - Intergenic
1110904301 13:80865955-80865977 TTAATATTGTTTTCTGGTAATGG - Intergenic
1111377589 13:87401023-87401045 GTAATCTTATGTGCTGCTATTGG - Intergenic
1111401985 13:87749664-87749686 ACAATCTTTTTTGCTGGTGGAGG - Intergenic
1113826124 13:113255188-113255210 GTAATGTTTTTGGCTGTTAGAGG + Intronic
1114943211 14:27642644-27642666 ATAATCTTTTTTGCTGGTGGTGG + Intergenic
1116014992 14:39395667-39395689 TTAATTTGGTTTGCTGGTTGTGG - Intergenic
1116387830 14:44354174-44354196 GTAATCTTTTTTGCTGGTGGAGG + Intergenic
1116968750 14:51042723-51042745 TTAGTCTTATTTGCAGGTAGGGG + Intronic
1117269707 14:54130341-54130363 ATAATCTTTTTTGCTGATGGAGG - Intergenic
1118176470 14:63445443-63445465 GTAATCTTTTTTGCTGGTGGAGG + Intronic
1118448713 14:65877157-65877179 GGAATCTACTTTGCTGGTTGAGG + Intergenic
1118927796 14:70208966-70208988 GTAATCTTTTTCACTGGTGGAGG + Intergenic
1121055835 14:90851712-90851734 GTAACCTTGTTTTCTTCTAGAGG + Exonic
1126399550 15:48255539-48255561 GAAATCTTGCTTGGTGGGAGAGG - Intronic
1126541191 15:49826019-49826041 GTCATCTTTTTTGCTGATACAGG + Intergenic
1128403453 15:67309763-67309785 GCAATCTGGTGTGCTGGGAGGGG + Intronic
1131615812 15:94016369-94016391 GAAATCTTGTTCACTGTTAGTGG + Intergenic
1141025822 16:80546340-80546362 GTATTCTTGTTTTCTACTAGCGG + Intronic
1144546309 17:16199265-16199287 GTAAATTTGTATGCTAGTAGGGG - Intronic
1149322793 17:55498478-55498500 TTCATCTTATTTGCTGGTAGTGG + Intergenic
1150504718 17:65686785-65686807 GTATTCCTGCTTCCTGGTAGAGG - Intronic
1153492680 18:5665660-5665682 CTAATCTTTTTTTCTGGTGGAGG + Intergenic
1153873879 18:9347874-9347896 GGAATTTTTTTTGCTGGTGGAGG + Intronic
1154504162 18:15018662-15018684 TTCATCTTGTTCGCTGGTACAGG + Intergenic
1155966732 18:32042767-32042789 GTAATCTCGTATGGGGGTAGGGG + Intronic
1159814609 18:73057499-73057521 CTTCTCTTCTTTGCTGGTAGAGG - Intergenic
1160332565 18:78008531-78008553 GAAATTATGTTTGCTGGTATTGG + Intergenic
1164490063 19:28702136-28702158 ATAATCTTTTTTGCTGGTGGAGG + Intergenic
1165921758 19:39303308-39303330 GAAATCTTGTTGGCTGGGTGTGG - Intergenic
925603486 2:5634155-5634177 GTATTCTTGTTTGTATGTAGTGG + Intergenic
926537914 2:14136334-14136356 GTAATCTTTTTTGCTGGTGAAGG - Intergenic
929281086 2:40079741-40079763 GTAATGTTGTTTTCTGATAGAGG - Intergenic
930322012 2:49867300-49867322 GTAATCATTTTTGCTGGTGGAGG + Intergenic
930545696 2:52764807-52764829 CTAATGTTGTTGGCTGGTATGGG + Intergenic
930919581 2:56735969-56735991 ATAATCTTTTTGGCTGGTGGAGG - Intergenic
932977663 2:76624206-76624228 GTATTCTTGTTTGGAGGTAAGGG + Intergenic
934053383 2:88229645-88229667 GTAGGCTGGTTTGATGGTAGTGG - Intergenic
934059182 2:88278560-88278582 GTAATCTTTTTTGCTGGTGGAGG - Intergenic
934689133 2:96344972-96344994 GTAATCTAGTCTACTGCTAGTGG - Intronic
937729383 2:125209250-125209272 ATAATTTTGTTTGGTGGTATGGG - Intergenic
938503345 2:131848865-131848887 TTCATCTTGTTCGCTGGTACAGG + Intergenic
940781571 2:157938920-157938942 TTAATCTTGTTTGCTTGTGGTGG + Intronic
942236271 2:173910004-173910026 GATATCTTGATTGCTGGTGGCGG + Exonic
943400396 2:187402643-187402665 CTACTCTGATTTGCTGGTAGTGG + Intronic
943876825 2:193076800-193076822 GAATACTTGTTTGCTGGTAAAGG - Intergenic
945794835 2:214349266-214349288 ATAATCTTGTTTGCTACAAGTGG - Intronic
945956609 2:216092165-216092187 GTCATCTTGTTGGCTGATGGAGG - Intronic
946747268 2:222858961-222858983 GTAATCTTTTTTGCTGGAGGAGG - Intergenic
1169695885 20:8385868-8385890 GATATCTTGATTGCTGGTGGAGG + Intronic
1169697004 20:8401001-8401023 GTAATCTTGATTGTTGTTGGTGG - Intronic
1176650683 21:9544176-9544198 GTAAATTTGTATGCCGGTAGGGG + Intergenic
1176726033 21:10433503-10433525 GTAAGGTTTTTTGCTGATAGAGG + Intergenic
1177288479 21:19080297-19080319 GTAATCTGCTATGCTGGTGGTGG + Intergenic
1177630446 21:23720548-23720570 GTACTCTTGTTTGCAGGTTTTGG - Intergenic
1180288340 22:10773610-10773632 GTAAGATTTTTTGCTGATAGAGG - Intergenic
1183026938 22:35072260-35072282 GTGCTCTTTTTTGCAGGTAGGGG - Intronic
1184126927 22:42493864-42493886 GTAATGTTTTTTGCTGGGCGCGG + Intergenic
949270314 3:2208796-2208818 GTAATCTTTGTTGCTGGTAGAGG - Intronic
953097927 3:39797028-39797050 GTAATCTTATTTGGTTATAGAGG + Intergenic
954001882 3:47564165-47564187 GTAATCTTGAATTTTGGTAGTGG - Intronic
954786671 3:53098473-53098495 GTAACCTTGATTGCTGGTGAGGG - Intronic
955927434 3:64022182-64022204 GTAATCATGCTTGCTTGTACTGG - Intronic
958197405 3:90258871-90258893 GTATTCTTGTACACTGGTAGTGG + Intergenic
961983159 3:131103483-131103505 TTAAGCGTATTTGCTGGTAGAGG + Intronic
963933655 3:151030337-151030359 GTAATAATGTCTTCTGGTAGTGG + Intergenic
964323755 3:155525013-155525035 GTCATCTTGTTTTTTGGTGGAGG - Intronic
964948847 3:162262062-162262084 TTAACCTTTTTTGCTGGTAGAGG - Intergenic
970640074 4:18054208-18054230 GGAAACTTGTTTGCTGGTTTTGG + Intergenic
970810808 4:20092005-20092027 GTAATGTAGTTTCCTGGCAGAGG + Intergenic
971925792 4:33007813-33007835 GTATTCTTGGTTGCTTTTAGTGG - Intergenic
972776489 4:42246122-42246144 GTCAAATTTTTTGCTGGTAGAGG - Intergenic
974605478 4:64145057-64145079 GTATTCTTGTTTGCAGTTATGGG - Intergenic
974678191 4:65123962-65123984 TTATTCTTGTTTGCTGAAAGAGG + Intergenic
975523954 4:75329077-75329099 CTAATCTTGACTTCTGGTAGAGG - Intergenic
975926435 4:79460480-79460502 GTAGTCTTGGGTGATGGTAGTGG - Intergenic
976762057 4:88559899-88559921 GAACTCTTGTGTGCTGTTAGTGG - Intronic
977144255 4:93416637-93416659 GTAATATTGTTTGCTAGTGATGG - Intronic
977962382 4:103100663-103100685 ATAGCCTTGTTTGCTGCTAGGGG + Intergenic
978610723 4:110535874-110535896 GTAATCTTTTTTACTGATAGAGG - Intronic
978610820 4:110537078-110537100 GTAATCTTTTTTACTGATAAAGG + Intronic
978667393 4:111200604-111200626 GTGATTTTTTTTGCAGGTAGTGG - Intergenic
983259646 4:165441859-165441881 ATTATCTTTTTGGCTGGTAGAGG + Intronic
986783510 5:11088888-11088910 TTATTATTGATTGCTGGTAGGGG + Intronic
986941706 5:12958858-12958880 GCAATCTCTTTTGCTGGTGGTGG - Intergenic
987732134 5:21787351-21787373 GTAATCTTGTTTGCTGGTAGAGG - Intronic
987920123 5:24268913-24268935 ATAATCTTTTTTGCTGGTGGAGG - Intergenic
990277409 5:54212756-54212778 TTAAGCATGTTTGGTGGTAGGGG + Intronic
991359767 5:65807332-65807354 ATAATCTTTTTTGCTGGTGGAGG - Intronic
991938744 5:71829581-71829603 ATAATCTCCTTTGCTGGAAGTGG - Intergenic
992568493 5:78026741-78026763 GTACTCTTGTATGCTGTTTGTGG - Intronic
993082657 5:83320713-83320735 GTAACCTTTTTTGCTGGTGCAGG - Intronic
995786953 5:115841009-115841031 GTAATGTTTTATGGTGGTAGGGG - Intronic
997901757 5:137773352-137773374 GAAATCTTGTTTCCTTTTAGTGG + Intergenic
999856757 5:155603291-155603313 GTAATCTTTTTTGCTGGTGGAGG + Intergenic
1003786116 6:9489235-9489257 GAGATCTTGTTTGATGGTGGAGG - Intergenic
1008442047 6:51542797-51542819 CTAGTCTTGTTTTATGGTAGTGG + Intergenic
1010689737 6:78895394-78895416 GTAATTTTCTTTGCTTGTAATGG - Intronic
1012767648 6:103388411-103388433 GATTGCTTGTTTGCTGGTAGGGG + Intergenic
1012928391 6:105291163-105291185 ATAACCTTTTTTGCTGGTGGAGG + Intronic
1014294008 6:119595601-119595623 ATAATCTTTTTTGCTGGGGGAGG + Intergenic
1014866277 6:126534197-126534219 GTGATCCTGGTTGATGGTAGGGG - Intergenic
1015304360 6:131690393-131690415 GTCATCTTTTTTGATCGTAGAGG - Intronic
1015721927 6:136251247-136251269 ACAATTTTGTTTGGTGGTAGTGG - Intergenic
1016178216 6:141107473-141107495 GTAATCATGCTTACTGTTAGAGG - Intergenic
1016885492 6:148955941-148955963 GTACACGTGTTTGTTGGTAGAGG - Intronic
1017067807 6:150546423-150546445 AAAATCTTGTTTGCTTGCAGGGG + Intergenic
1017533237 6:155318511-155318533 GTTAACCTTTTTGCTGGTAGAGG + Intergenic
1017749379 6:157476593-157476615 GTAATTTTCTTTTCTTGTAGGGG - Intronic
1018877250 6:167833562-167833584 TTATTCTTGTTTGCTCATAGTGG + Intronic
1019956544 7:4419309-4419331 GTAATTTTTTTTGGTGGTGGTGG - Intergenic
1020470871 7:8532956-8532978 GTAATCCTGGCTGCTGGCAGTGG - Intronic
1022235141 7:28453889-28453911 GTAAACCTTTTTGCTGGAAGAGG + Intronic
1025277362 7:57595134-57595156 GTAAATTTGTATGCTAGTAGGGG + Intergenic
1027573627 7:79903723-79903745 ATAATCTTTTTTGCTGGTGGAGG - Intergenic
1028345026 7:89769193-89769215 ACAATTTTTTTTGCTGGTAGAGG - Intergenic
1028769928 7:94607322-94607344 GTAATGTTGTTTTCTGGTTTTGG - Intronic
1031023800 7:116658269-116658291 GTTATGTTGTTTGGTTGTAGAGG + Intergenic
1032235340 7:130117219-130117241 GTAATCTTTTTTGCTGGTGGAGG + Intronic
1032527642 7:132591858-132591880 GTAATCCTGTTTTCTGGGAGAGG - Intronic
1034611889 7:152378383-152378405 GTAAGATTTTTTGCTGATAGAGG - Intronic
1036387935 8:8297985-8298007 GTAATCTTGATTGCTGATAGTGG + Intergenic
1038417085 8:27404881-27404903 GTAATGGTGTTTGAAGGTAGGGG + Intronic
1040841289 8:51787964-51787986 GTAAGCTTTTTTTCTGGTGGAGG - Intronic
1042579393 8:70260040-70260062 GTAACTTTGTTTCCTGGTAGTGG - Intronic
1043057872 8:75463182-75463204 GTATTGTTGTTTGCTGGTATAGG + Intronic
1043305823 8:78793577-78793599 GTAAACTTTTTTGCTGGTGGAGG + Intronic
1045948259 8:107821981-107822003 GTAATCTTTTCTGCTGGTAGAGG + Intergenic
1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG + Intronic
1050845909 9:10217985-10218007 GTAATCTTTTTTCGGGGTAGGGG + Intronic
1052591798 9:30506265-30506287 GCAATCTTTTTTGCTGGTGGAGG + Intergenic
1055699284 9:78924906-78924928 AGGATCTTTTTTGCTGGTAGGGG - Intergenic
1055818743 9:80237790-80237812 GTTATCTTGGTTGCTGGTGCAGG - Intergenic
1056649795 9:88448806-88448828 CTTAACATGTTTGCTGGTAGTGG + Intronic
1058285694 9:103175509-103175531 GTACATTTGTTTGCTGGTACAGG + Intergenic
1203744636 Un_GL000218v1:35097-35119 GTAATCTGGGATGCTGGCAGGGG + Intergenic
1186969691 X:14828155-14828177 GTAATTTTTTTTGCTAGTCGAGG + Intergenic
1188106618 X:26155182-26155204 GTAACCTTTTTTGCTGGTGGAGG + Intergenic
1188157779 X:26761805-26761827 GTGCTCTTGATTTCTGGTAGTGG + Intergenic
1188665356 X:32812753-32812775 ATAAGCTTGTTAGCTGTTAGGGG - Intronic
1195634984 X:107103888-107103910 GTAATCTTCTGTGTTGATAGGGG + Intronic
1196564178 X:117185594-117185616 GTAATTTTTTTTGATGGTGGAGG - Intergenic
1198036798 X:132808855-132808877 GTAGTCTTGTGTGAAGGTAGTGG - Intronic
1198125184 X:133636785-133636807 CTGATCTTGTTTTGTGGTAGGGG + Intronic