ID: 987737840

View in Genome Browser
Species Human (GRCh38)
Location 5:21868379-21868401
Sequence GTCTCAAGAAACCAAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987737836_987737840 14 Left 987737836 5:21868342-21868364 CCAGACAAAGCATAGTGGATCCC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203
987737832_987737840 20 Left 987737832 5:21868336-21868358 CCCCAACCAGACAAAGCATAGTG 0: 1
1: 0
2: 1
3: 14
4: 141
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203
987737839_987737840 -7 Left 987737839 5:21868363-21868385 CCTGAGAGTAGAGCTGGTCTCAA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203
987737838_987737840 -6 Left 987737838 5:21868362-21868384 CCCTGAGAGTAGAGCTGGTCTCA 0: 1
1: 1
2: 0
3: 9
4: 223
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203
987737835_987737840 18 Left 987737835 5:21868338-21868360 CCAACCAGACAAAGCATAGTGGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203
987737833_987737840 19 Left 987737833 5:21868337-21868359 CCCAACCAGACAAAGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987737840 Original CRISPR GTCTCAAGAAACCAAACTGT AGG Intronic
901264465 1:7899735-7899757 GTTTCAAGACACTAAATTGTGGG - Intergenic
903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG + Intergenic
906111753 1:43328398-43328420 GTCTCAAAAAAACAAAGAGTTGG + Intergenic
908447504 1:64214635-64214657 CTCTCAAGAAACCTAACCTTAGG - Intronic
914434686 1:147649446-147649468 GTCTCAAAAAAAAAAAATGTTGG - Intronic
914769338 1:150669958-150669980 GTCTCAAAAAAAAAAACTGCAGG + Intronic
915435412 1:155901813-155901835 GTCTCAAGAAAAAAAAAAGTTGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917214123 1:172660225-172660247 GTGTACAGAAACCAAAGTGTGGG - Intronic
917882675 1:179353782-179353804 GTCACTTGAAGCCAAACTGTTGG + Exonic
919554126 1:199030448-199030470 GTCACAAGAAACCTAACTCAAGG - Intergenic
919850665 1:201669890-201669912 GTCACCAGAAACCTCACTGTGGG - Intronic
921402608 1:214742853-214742875 GGCTCAAGAAACCTAGCTTTTGG + Intergenic
922491515 1:226020813-226020835 GTCCCAACAAAACAAACTCTTGG - Intergenic
923567849 1:235090157-235090179 GTCTCAAAAAAAAAAGCTGTAGG + Intergenic
1063289375 10:4727909-4727931 TTCTCAGGAAACCAACCTTTAGG - Intergenic
1066256845 10:33688011-33688033 TTCTCAAGAAACCAACCATTCGG + Intergenic
1067412457 10:46076843-46076865 GTCTCAAAAAACAAACCTGCTGG + Intergenic
1068050978 10:51948819-51948841 TTGTCAATAAACTAAACTGTAGG + Intronic
1068542812 10:58314366-58314388 TTCTCAACAAACCAAACCTTAGG + Intergenic
1068633689 10:59324802-59324824 ATCTAAAGAAACCACAATGTGGG + Intronic
1070509546 10:77147812-77147834 GTCTCAATAATCAAACCTGTGGG - Intronic
1071192568 10:83119218-83119240 GTAACAAGAAATCAATCTGTGGG + Intergenic
1071832800 10:89388845-89388867 GTTGCAGTAAACCAAACTGTGGG + Intronic
1076079681 10:127567763-127567785 GAGTCAAGACACTAAACTGTTGG - Intergenic
1084340451 11:68495985-68496007 GTCTCAAAAAACAAAAGTGCTGG - Intronic
1085421151 11:76361762-76361784 GTCTTAAGTAATAAAACTGTAGG + Intronic
1086544880 11:87956532-87956554 GTCTGTAGAAACCAAACGGCAGG + Intergenic
1086727397 11:90204704-90204726 GTCTCAAGAAAAAAAAAAGTGGG + Intronic
1088275574 11:108081747-108081769 GTCTCAAGAAAAAAATCAGTTGG + Intronic
1090725553 11:129523426-129523448 GTCTCAAGGAAAAAAATTGTTGG + Intergenic
1092216112 12:6684012-6684034 GTCTCAAAAAAAAAAACTGGTGG + Intronic
1093255009 12:16856285-16856307 GTCTAAGAAAACTAAACTGTTGG - Intergenic
1093534190 12:20202987-20203009 ATATCACGAAACCCAACTGTGGG + Intergenic
1095139388 12:38642938-38642960 CTCTCAAGAAACCATATTTTTGG - Intergenic
1095556561 12:43513286-43513308 TTCTCAAGAAACCAACCCATAGG + Intronic
1098050319 12:66446112-66446134 GACTGAAGAGACCAAACTCTGGG - Intronic
1100652460 12:96605309-96605331 GTATCAAGAAACCAAACAGCTGG + Intronic
1101497943 12:105273347-105273369 TTCCCAAGAAACAAAACGGTTGG + Intronic
1101519914 12:105472295-105472317 GTCTGTAGAAATCAAACTGCTGG + Intergenic
1103780534 12:123395857-123395879 GTCTCAAAAAACACAACAGTCGG - Intronic
1106175635 13:27328858-27328880 GCATTAAAAAACCAAACTGTAGG + Intergenic
1107034449 13:35885824-35885846 GTCTGAAGAAATAAAACTTTGGG + Intronic
1107273093 13:38643341-38643363 GTCTCAAAAAACAAAAAAGTTGG + Intergenic
1112918472 13:104580001-104580023 TCCTCAGGAAACCAAACTGAAGG - Intergenic
1114506671 14:23220527-23220549 GTCTCAAAAAACAAAACAGCCGG + Intronic
1114928344 14:27433926-27433948 GTCACAGAAAACCAAGCTGTGGG - Intergenic
1114939712 14:27593080-27593102 GACTCAGGAAACAAAAATGTGGG + Intergenic
1115460591 14:33655834-33655856 GTCTCAAAAAACCACAAAGTTGG + Intronic
1117464430 14:55978169-55978191 GACTCCAGAACCCAGACTGTGGG + Intergenic
1118242975 14:64079609-64079631 GACTCAAGAAACCAATAGGTTGG - Intronic
1118382437 14:65228336-65228358 GTCTCAAAAAAACAAAAAGTAGG + Intergenic
1119066803 14:71536397-71536419 GCTTCAAGACAACAAACTGTGGG - Intronic
1121594427 14:95148831-95148853 GTCTCTTGAAACAAAACTGTAGG - Intronic
1121780724 14:96620331-96620353 GTCTCAAAAAAAAAAATTGTTGG - Intergenic
1122850788 14:104529221-104529243 GTCTCAAGAAAAAAAAAAGTGGG + Intronic
1123005235 14:105318281-105318303 GTCTCTAAAAACCAAACAGATGG - Intronic
1123672511 15:22673589-22673611 GTTTCAAAATACCACACTGTAGG + Intergenic
1123777758 15:23597537-23597559 GTCTCAAAAAAACAAACGGCCGG + Intronic
1124324561 15:28746878-28746900 GTTTCAAAATACCACACTGTAGG + Intergenic
1125096259 15:35855800-35855822 GTCACTGGAAACCAAATTGTGGG + Intergenic
1125270743 15:37936047-37936069 TTCTCAAGAAACCAGAGTGAAGG + Intronic
1127320476 15:57840467-57840489 GTCTTAAGCAACCAAACTGGGGG + Intergenic
1127621022 15:60734594-60734616 GTCCCAAGAAATCTAACAGTGGG - Intronic
1128584973 15:68840501-68840523 GTATCTAGAAACCAAAATTTAGG - Intronic
1130456416 15:84114460-84114482 CTCTCAAGATACATAACTGTAGG - Intergenic
1133092808 16:3417872-3417894 GTCTCAAAAAACAAAATGGTTGG + Intronic
1135429259 16:22368509-22368531 GTCTCTAGAAAACAAAAAGTAGG - Intronic
1139841762 16:69887396-69887418 GTCTCAAAAAAAAAAAGTGTTGG - Intronic
1141586946 16:85040362-85040384 TTGTCAAGAAACCCCACTGTTGG + Intronic
1143214957 17:5218026-5218048 GTCTCAAAAAAAAAAAATGTTGG - Intronic
1146418523 17:32660357-32660379 GTCTGCAGAACCCATACTGTGGG - Intronic
1146911295 17:36650011-36650033 CTCTCAAGAATCCAACCTGAAGG + Intergenic
1149340082 17:55676281-55676303 GTCTCAAGAAACACAACCTTTGG + Intergenic
1153016267 18:584918-584940 GTCTCAAGAAAAAAAAGTGGGGG - Intergenic
1153181460 18:2439679-2439701 ATCTCAAGAAACCAATTTCTTGG + Intergenic
1155468018 18:26160806-26160828 ACCTCAAAAAACCAAACTGCTGG - Intronic
1155778286 18:29795599-29795621 GTTTCAAGACACCAAATTTTTGG - Intergenic
1156006578 18:32449658-32449680 GTCTCAAAAAAACAAAGGGTTGG + Intronic
1156026870 18:32664503-32664525 GTTTAAAGAAAGCATACTGTAGG + Intergenic
1156564760 18:38175103-38175125 GCCTGAAGAAACCAAATTTTGGG - Intergenic
1159747737 18:72259521-72259543 TTCTCAAAAAACAAAACTATAGG + Intergenic
1160605975 18:80049656-80049678 GGCTCATAAAACCAGACTGTCGG + Intronic
1160699617 19:499584-499606 GTGTCAAGAAACGAAACAGAAGG - Intronic
1164074497 19:21801552-21801574 GTCTCAAAAAAACAAAATGGAGG + Intergenic
1164508974 19:28882308-28882330 GTCTCAAGAAACGAATTTGGGGG + Intergenic
1165442875 19:35840628-35840650 GTTTAAAGAAACCTAACTGCCGG - Intronic
1167659351 19:50786936-50786958 GTCTCACTTAACCAAAGTGTTGG - Intergenic
1168042591 19:53770187-53770209 GTCTCAAAAAACAACACCGTAGG + Intergenic
925519393 2:4725067-4725089 GTCTCAAGAAAAGAAAGTATAGG - Intergenic
927367958 2:22320619-22320641 TTCTCTAAAAAACAAACTGTCGG - Intergenic
927734144 2:25503238-25503260 GTCTCAACCTACCAAAGTGTTGG - Intronic
929233529 2:39584114-39584136 GTCTCAACAGACAAATCTGTTGG + Intergenic
930126192 2:47799067-47799089 GTTTCATGATACCAAACAGTAGG - Exonic
930178732 2:48328617-48328639 CTGTCAAAAAACCAAACTGCTGG + Exonic
931187681 2:59969341-59969363 GTCTCAGGAAGCAAATCTGTAGG + Intergenic
931256731 2:60580826-60580848 GTCCCAAGAACCCAATGTGTGGG + Intergenic
932049426 2:68383939-68383961 GGATCAAGACACCAAGCTGTGGG + Intronic
933855286 2:86407790-86407812 GTCTCAAGCTCCCAAAGTGTTGG - Intergenic
934660659 2:96141989-96142011 GTCTCAGGAAAACAAGCTCTGGG - Intergenic
935380307 2:102445085-102445107 TTCTCTAAAAGCCAAACTGTTGG + Intronic
935632269 2:105221833-105221855 GGCACCAGAAACCACACTGTAGG - Intergenic
937813384 2:126223255-126223277 ATCTCAAAAAAGCAAACAGTTGG - Intergenic
939785562 2:146506923-146506945 ATCACAAGATACTAAACTGTTGG + Intergenic
940515537 2:154679943-154679965 GTCTGAAAATTCCAAACTGTGGG - Intergenic
942175986 2:173335132-173335154 CTCTCAAAAAACAAAACAGTTGG - Intergenic
943083933 2:183289433-183289455 GTCTCAAGACACCTAGCTTTTGG - Intergenic
945176995 2:207053066-207053088 GTCTGAGGAAACCAAAATGGTGG + Intergenic
946168627 2:217880454-217880476 GCCTGAAGAAACCCAACAGTGGG + Intronic
947110443 2:226713116-226713138 GTGTCAAGAAAGAGAACTGTTGG + Intergenic
948511343 2:238467243-238467265 GTCTCCAGAAAACAAAATGGGGG - Intergenic
1168802840 20:654081-654103 GTCACACGAGTCCAAACTGTGGG + Intronic
1170060172 20:12250634-12250656 GTCCCAAGAAAACCAACTGATGG - Intergenic
1171895832 20:30759870-30759892 GTCTCAAAAAAAAAAAATGTTGG + Intergenic
1175241397 20:57552175-57552197 GCCTCCAGAACCCACACTGTTGG + Intergenic
1178570474 21:33731047-33731069 TTCTCAATAAACATAACTGTGGG - Intronic
1180244190 21:46535776-46535798 GGCTAAAGAACCCAAATTGTAGG - Intronic
1183031844 22:35112389-35112411 GTCTCAAAAAAAAAAAATGTAGG - Intergenic
1183324022 22:37181683-37181705 GTCTCAAGAAAAAAAAATGTTGG + Exonic
1183884578 22:40867768-40867790 TTCTAAAGCATCCAAACTGTTGG + Intronic
1184458039 22:44622382-44622404 GTCTCAGAAAACCCACCTGTGGG + Intergenic
1184831079 22:46988030-46988052 GTCTCAAGAAACCACTTTCTTGG + Intronic
949988136 3:9555340-9555362 GTCTCAAGAAGCCAAATGGAAGG - Intergenic
952183529 3:30944115-30944137 GTCCTCAGAAACAAAACTGTTGG - Intergenic
956361020 3:68447352-68447374 CTGTCTAAAAACCAAACTGTTGG + Intronic
956801385 3:72762675-72762697 GTCTCAAGAAAAAAAACTGGAGG - Intronic
957815211 3:85289602-85289624 GTCTGTAGACACCAAACTGAAGG - Intronic
958521564 3:95195530-95195552 GTATCAGGAAATCTAACTGTTGG + Intergenic
963198827 3:142566316-142566338 TTGTTAAGAAACCAGACTGTGGG + Intronic
963643681 3:147887357-147887379 GTCTCCAGAAACCCTAATGTTGG - Intergenic
963853589 3:150231732-150231754 GTATCTAGAAGCTAAACTGTTGG - Intergenic
963919017 3:150888102-150888124 GTCTCAAAAAACAAAAGAGTAGG + Intronic
964122988 3:153205973-153205995 GTCTCAACCTCCCAAACTGTTGG - Intergenic
964303519 3:155315823-155315845 TGCTCAAAAAACAAAACTGTAGG + Intergenic
965466240 3:169034044-169034066 GCCTCAAGAAATCAGACTGTGGG - Intergenic
966319311 3:178683348-178683370 GTCTCAAAAAAACTAACTGTTGG + Intronic
967400297 3:189053419-189053441 TTCTCAGGAAACCAAACATTTGG + Intronic
968301236 3:197617532-197617554 GTCACAAGAAACAGAACTGGAGG + Intergenic
968475069 4:801012-801034 GTCTCAAAAAAACAAAAGGTTGG + Intronic
970061342 4:12037879-12037901 GTCTCAAAAAACCACAGTCTGGG - Intergenic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
973128187 4:46615092-46615114 GGCTCAAGAAGCCTAGCTGTTGG - Intergenic
973777625 4:54257598-54257620 GACTCAAGAAGCCACACTGAGGG - Intronic
977380283 4:96264120-96264142 GTCTAAGGAAAATAAACTGTGGG - Intergenic
980023931 4:127742287-127742309 TTCTCAGGAAACCAACCTTTGGG + Intronic
981876448 4:149551963-149551985 TTCTCTAGAAACCAGGCTGTTGG + Intergenic
982064008 4:151635627-151635649 GTCACAAAAAGACAAACTGTAGG + Intronic
982141366 4:152322910-152322932 GACTGAAGAAACCAAGCTGCTGG - Exonic
982373922 4:154666206-154666228 CTCTCCAGACACCAAACAGTTGG - Intronic
982738479 4:159032215-159032237 GTCTCAAAAAAAAAAATTGTTGG + Intronic
987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG + Intronic
989439905 5:41458022-41458044 GTCTCAAGCAACCATAATGATGG - Intronic
990241601 5:53821781-53821803 GTCTTCAGAATGCAAACTGTAGG + Intergenic
990295041 5:54392954-54392976 GGTTCAAGAAAAAAAACTGTTGG - Intergenic
990903283 5:60776700-60776722 GACTGAAGAATCCAAAATGTGGG + Intronic
991214270 5:64144262-64144284 GGCTCATGAAACCAAATTATAGG + Intergenic
992299641 5:75365021-75365043 GTCTCAAAAAACAAAATTATTGG - Intergenic
992466381 5:77009801-77009823 GGCTGATGAAACCAAACTGCTGG + Intergenic
993624012 5:90201796-90201818 AACTCAAGGAAACAAACTGTGGG + Intergenic
994848914 5:105027592-105027614 TGCTCCAGAAACCAAACTGATGG + Intergenic
996940667 5:129001414-129001436 CTGTGAAGAAAGCAAACTGTTGG + Intronic
998461090 5:142310698-142310720 GTAACATGAAACCAAGCTGTGGG + Exonic
998833970 5:146186513-146186535 GTCTCAAAAAACAAAACAGCCGG + Intergenic
1000023693 5:157340741-157340763 CTCTTGAGAAACCAAACTGGAGG + Intronic
1001899114 5:175408562-175408584 TTCTGAAGAAGCAAAACTGTAGG - Intergenic
1005304409 6:24499285-24499307 GTCTCAAAAAACAAAAATGAAGG + Intronic
1009614812 6:65990750-65990772 GACAAAAGAAACCAAACTGCAGG + Intergenic
1011276180 6:85633689-85633711 GTCTCAAAAAACCAAAAAGGGGG - Intronic
1011592347 6:88982334-88982356 TTCTCAACCAACCACACTGTGGG + Intergenic
1012060717 6:94476460-94476482 GTCTCAAAAAAGCAAACAGCTGG - Intergenic
1012227677 6:96723703-96723725 TTCTCAGGAACCCAAAATGTAGG + Intergenic
1015457879 6:133449885-133449907 GGCTAAAGAAAGCAAACTTTTGG + Intronic
1015769753 6:136756312-136756334 GTCTCAAAAAAACAAAATGCAGG + Intronic
1015968181 6:138716207-138716229 GGCTCATGTAATCAAACTGTGGG - Intergenic
1016684568 6:146866753-146866775 TTTTCTAAAAACCAAACTGTGGG - Intergenic
1021451453 7:20786281-20786303 GCCAAAAGAAATCAAACTGTAGG + Intronic
1022394418 7:29973127-29973149 GACTGAAGAAAACAAACTTTAGG + Intronic
1022957323 7:35393169-35393191 GTCCCAAGAAAGCCAAGTGTTGG + Intergenic
1024198801 7:47086403-47086425 TTCTCAAGAAAGGAAATTGTGGG - Intergenic
1026915523 7:74117805-74117827 GTCTCAAGAAAACAAAAAATAGG + Intronic
1027256447 7:76433701-76433723 GTCTCAAAAAGCCAAACAGGTGG - Intronic
1027470065 7:78562437-78562459 GTTTAAAGAATCCAAACAGTAGG + Intronic
1027566319 7:79799512-79799534 GGCACAAGACTCCAAACTGTGGG - Intergenic
1028315184 7:89392852-89392874 GGATCAAGACTCCAAACTGTGGG - Intergenic
1030741581 7:113116137-113116159 GTCTAAGGAAATCAAACTTTAGG - Intergenic
1033806621 7:144961629-144961651 GTCTTTAGAAACCAAAATGTGGG + Intergenic
1036488334 8:9200194-9200216 GTCTCAAAAAAAAAAAGTGTTGG - Intergenic
1036495274 8:9264697-9264719 TTTTCAAGAACCCAAACTGTTGG - Intergenic
1037572222 8:20167920-20167942 GTGTTTAGAAACCAAACTATGGG - Intronic
1038214115 8:25545949-25545971 TTCTCAAGAAAACAAAGAGTGGG - Intergenic
1038585554 8:28785653-28785675 GTATCTAGAAACCAACATGTGGG + Intronic
1039750530 8:40474214-40474236 GTCTCTAGAACTCAAATTGTAGG + Intergenic
1040662194 8:49586954-49586976 TTCTCAAGAAACCAATTTTTAGG - Intergenic
1041621475 8:59974880-59974902 GTCTTAAGAAACTAAACTTGTGG + Intergenic
1045175033 8:99713701-99713723 GTATCTAGAAACCAAAATCTGGG - Intronic
1045862948 8:106833640-106833662 GTCAGAAGACACCAAGCTGTTGG - Intergenic
1047283387 8:123465033-123465055 GTCTCAGGAAAAAAAAGTGTGGG + Intronic
1047648533 8:126895131-126895153 GTGTCAAGAAGGCAAACAGTAGG + Intergenic
1050543378 9:6689135-6689157 GTCTCCAAAAACAAAAATGTAGG - Intergenic
1051911839 9:22161737-22161759 GTCTCAAGAAGCAAAACTATAGG - Intergenic
1055873394 9:80913607-80913629 TTCTCAAGAAACAAAATTTTTGG - Intergenic
1058579379 9:106438506-106438528 TTCTCAAAAAACCAATCTGAAGG + Intergenic
1059386431 9:113968510-113968532 GTCTCATGAAAACAAACTCCAGG - Intronic
1059952833 9:119484939-119484961 GTCTGATGAACCCAAACTGAGGG + Intergenic
1060096586 9:120796163-120796185 ATCTCAAGAAACCAAACAGCTGG - Intergenic
1061682060 9:132247646-132247668 GTCTCAAAAAAACAAACAGCTGG + Intergenic
1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG + Intronic
1189624428 X:42880694-42880716 GTAACAAGAAACCGAATTGTGGG - Intergenic
1191645473 X:63476086-63476108 GGCTCAAGCAACCACACTATAGG + Intergenic
1192110081 X:68354972-68354994 GTCTTCATAAACCCAACTGTTGG + Intronic
1192942683 X:75929765-75929787 ATATCTAGAAACCAAACTATTGG + Intergenic
1194556506 X:95367345-95367367 GTATCATGAAACCCAACTGGGGG - Intergenic
1195946871 X:110223854-110223876 GACTCCAGAACCCAAGCTGTTGG - Intronic
1196494526 X:116308333-116308355 TTTTCATGAAAGCAAACTGTTGG - Intergenic
1198644849 X:138795069-138795091 CGCTCAAGAAGCTAAACTGTAGG + Intronic
1198697764 X:139361939-139361961 ATCTCACAAAACCATACTGTAGG + Intergenic
1200584703 Y:4994153-4994175 TTCTCAACGAACAAAACTGTTGG + Intergenic
1201379861 Y:13363200-13363222 GTCTCAAAAAAACAAAATGAAGG - Intronic