ID: 987738076

View in Genome Browser
Species Human (GRCh38)
Location 5:21870458-21870480
Sequence CTGTGCTATCCTATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 17, 3: 82, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987738076_987738080 15 Left 987738076 5:21870458-21870480 CCTTCCACCATAGGATAGCACAG 0: 1
1: 0
2: 17
3: 82
4: 422
Right 987738080 5:21870496-21870518 CAGATGTAGCCATTCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987738076 Original CRISPR CTGTGCTATCCTATGGTGGA AGG (reversed) Intronic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
900909211 1:5582868-5582890 CTGCATCATCCTATGGTGGAAGG - Intergenic
901000830 1:6148018-6148040 CTGTGCTTTCCTAGGATTGATGG - Intronic
902100905 1:13987939-13987961 CTGTGTCATCCCATGGTAGAAGG + Intergenic
902694304 1:18129893-18129915 CTGTGTCATCCCATGTTGGAAGG - Intronic
902921176 1:19666629-19666651 CGGAGCTATCCTGTGGTGGGTGG - Intronic
903551845 1:24162622-24162644 CTGTGTCATCCCATGGTGGCAGG + Intronic
904550250 1:31310605-31310627 TTGTGTCATCCCATGGTGGAAGG - Intronic
905491805 1:38350156-38350178 CTGTATCATCCCATGGTGGAAGG + Intergenic
905524310 1:38624825-38624847 CTGTGGTTTCCTATGGAGCAAGG - Intergenic
906697851 1:47836793-47836815 CTGTGTCCTCATATGGTGGAAGG - Intronic
907680674 1:56560540-56560562 CTGTGTTCTCATATGATGGAAGG + Intronic
908388531 1:63664851-63664873 CTGTGTCCTCCCATGGTGGACGG + Intergenic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
909694535 1:78451472-78451494 CTGTGCCCTCATATGGTGGAAGG - Intronic
909832411 1:80209294-80209316 CTGTGTTGTCACATGGTGGAAGG - Intergenic
910093612 1:83494684-83494706 TTGTGTCCTCCTATGGTGGAAGG + Intergenic
911228533 1:95334434-95334456 CTGTGTTCTCATATGGTGGAAGG + Intergenic
911392746 1:97267513-97267535 CTGTGTCATCCCACGGTGGAAGG + Intronic
911558292 1:99373000-99373022 CTGTATCATCCTATGGAGGAAGG - Intergenic
912330884 1:108819015-108819037 CTGTGCTAGACTATGGTGGAGGG + Intronic
912957541 1:114165993-114166015 CTGTGCTAACCTAGGGTTGGGGG + Intergenic
913056103 1:115161241-115161263 CTGTGTCCTCATATGGTGGAAGG + Intergenic
913228884 1:116724549-116724571 CCGTGACATCCCATGGTGGAAGG + Intergenic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
915739176 1:158105362-158105384 ATGTGCTATTTTATGTTGGATGG + Intergenic
916386759 1:164281757-164281779 CTGCATTATCCTCTGGTGGAAGG - Intergenic
919161990 1:193841879-193841901 CTGTGTCATCCTATTGTGGAAGG + Intergenic
919434386 1:197538920-197538942 CTGTGTCATCCCATGGTGGAAGG - Intronic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
922783418 1:228271193-228271215 CTGTGCCATCCAATGCTGGATGG - Intronic
922808509 1:228402756-228402778 CTGTGTTGTCATATGGTGAAAGG - Intronic
922962497 1:229660931-229660953 CTGTGCTATCTTGTGGGGGCTGG + Intergenic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
924764051 1:247015219-247015241 CTGTGCTCTGCTTTGGTGAAAGG - Intergenic
1063010192 10:2014073-2014095 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1063618971 10:7627403-7627425 CTGTGCTAGTCTCTGGTCGAGGG + Intronic
1064722920 10:18247938-18247960 CTGTGTTCTAATATGGTGGAAGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1064856461 10:19773757-19773779 CTGTGTCCTCATATGGTGGAAGG + Intronic
1065269589 10:24013977-24013999 CTGTTCCATACTTTGGTGGAAGG - Intronic
1065881886 10:30044091-30044113 CTGTGTCATCTCATGGTGGAAGG - Intronic
1066757063 10:38721903-38721925 CTGTGTCATCCCATGATGGAAGG + Intergenic
1067137405 10:43623488-43623510 CTATGTCATCCCATGGTGGAAGG + Intergenic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1067162321 10:43837692-43837714 CTGTATCATCCCATGGTGGAAGG + Intergenic
1067219204 10:44330993-44331015 TTGTGTCATCCCATGGTGGAAGG + Intergenic
1067583185 10:47458414-47458436 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1068065003 10:52119844-52119866 CTGTGTTATCCAATGGCAGAAGG + Intronic
1068587640 10:58817107-58817129 CTGTGCTTTCCTTTGGTCAAAGG - Intronic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1069730274 10:70607029-70607051 CTGTGACCTCATATGGTGGAAGG - Intergenic
1070968077 10:80541978-80542000 ATGTTCTATGCTGTGGTGGATGG + Intronic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1072021650 10:91409590-91409612 CCGTCCAATCCTATGGGGGAAGG + Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1077980386 11:7294079-7294101 CTGTGTCCTCATATGGTGGAAGG + Intronic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1078457960 11:11490272-11490294 CTGTATTATCCCATGGTGGAAGG - Intronic
1079121910 11:17691980-17692002 CTGTGCTATGCTATGTTGTATGG - Intergenic
1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG + Intergenic
1079341944 11:19618621-19618643 CTGTGCTAAGCTGTGGTGGTGGG + Intronic
1079556299 11:21761805-21761827 CTGTGTCATCCTATGGTGAAAGG + Intergenic
1079873412 11:25828676-25828698 CTATGTCATCTTATGGTGGAAGG + Intergenic
1080902988 11:36513147-36513169 CTGTGTCATCCTATGTTGGAGGG - Intronic
1081059486 11:38455651-38455673 CTGTGATCTCACATGGTGGAAGG - Intergenic
1082931600 11:58613268-58613290 CTGTGTCAGCCCATGGTGGAAGG + Intronic
1085030491 11:73268229-73268251 CTGTGGTTTCCTATGATGGAAGG + Intronic
1085729437 11:78983772-78983794 CTGTCCTATCCTGTGGGGGTGGG + Intronic
1085883826 11:80499104-80499126 CTGTGTCCTTCTATGGTGGAAGG - Intergenic
1085923939 11:80991842-80991864 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1086524636 11:87711186-87711208 CAGTGCTATCCCAGGCTGGAGGG + Intergenic
1086744733 11:90410842-90410864 CTGTGTTTTCACATGGTGGAAGG + Intergenic
1087775499 11:102253126-102253148 CTGTGTGATCTCATGGTGGAAGG + Intergenic
1089942359 11:122431718-122431740 CTATGTCATCCCATGGTGGAAGG - Intergenic
1091294304 11:134462083-134462105 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1091531375 12:1359502-1359524 CTGTGTCATCCCACGGTGGAAGG + Intronic
1091931490 12:4399284-4399306 CTGTGTTATTCCATGGTAGAAGG + Intergenic
1093790439 12:23243979-23244001 CTATGTTATCCCATGGAGGAAGG - Intergenic
1094263786 12:28530953-28530975 CTGTGATATCCCATGCTGGAAGG - Intronic
1094542455 12:31373764-31373786 CTGTGCACTCACATGGTGGAAGG - Intergenic
1094729324 12:33156810-33156832 ATGTGCTGTCCAATGTTGGAGGG + Intergenic
1095529850 12:43174142-43174164 CTATGTCATCCCATGGTGGAAGG - Intergenic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1095882035 12:47148081-47148103 CTATGCCATCGCATGGTGGAAGG + Intronic
1096005313 12:48165786-48165808 CTGTGTCCTCATATGGTGGAAGG - Intronic
1098235524 12:68414547-68414569 CTGTGGTCTCACATGGTGGAAGG - Intergenic
1098536387 12:71597963-71597985 CTGTGTTCTTATATGGTGGAAGG - Intergenic
1099353127 12:81598386-81598408 CTCTGCTAGACTGTGGTGGAGGG - Intronic
1099360818 12:81698398-81698420 CTGTGTCATCTCATGGTGGAAGG - Intronic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1101104143 12:101423585-101423607 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1101451698 12:104785695-104785717 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1101833135 12:108274828-108274850 ATGGGCCATCCCATGGTGGAAGG - Intergenic
1102558423 12:113744762-113744784 CTGTGTTATCCCATGGTGAAAGG + Intergenic
1103234176 12:119358392-119358414 CTGTGTCATCCCATGGTGGAAGG - Intronic
1105530012 13:21210783-21210805 CTGTGTCATCCCATGGTTGAAGG + Intergenic
1105607195 13:21935771-21935793 CTGTGTCATCCTATAGTGGGAGG - Intergenic
1105761946 13:23523251-23523273 CTGTGTCTTCCCATGGTGGAAGG + Intergenic
1105808226 13:23971497-23971519 CTGTGTCATCCCATGGTAGAAGG - Intergenic
1105934143 13:25083172-25083194 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1106012809 13:25841883-25841905 ATGTGTCATCCCATGGTGGAAGG + Intronic
1106738913 13:32618028-32618050 CTGTGTTCTCATATGGTGGAAGG + Intronic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1107146294 13:37064006-37064028 GTATGTTATCCCATGGTGGAAGG + Intergenic
1107349168 13:39496257-39496279 TTGTGTTCTCCCATGGTGGAAGG + Intronic
1107880567 13:44828840-44828862 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1108199701 13:48031031-48031053 CTGTATCATCCCATGGTGGAAGG + Intergenic
1108246231 13:48517083-48517105 TTGTGCTCTCCTAAGGTGGAAGG - Intronic
1108440091 13:50443434-50443456 CTGTGCCCTCATATGGTAGAAGG - Intronic
1109361371 13:61298926-61298948 CTGTGCTATACTGGGGTGGTGGG - Intergenic
1109881020 13:68476574-68476596 CTCTGCCATCCTCTTGTGGAGGG - Intergenic
1110486447 13:76050453-76050475 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1110487300 13:76061551-76061573 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1110836879 13:80093607-80093629 TTTGGCTGTCCTATGGTGGAGGG + Intergenic
1111699552 13:91669387-91669409 ATGTACTATTCTATTGTGGAGGG - Intronic
1111883486 13:93988601-93988623 CTGTGTTCTCATATGGCGGAAGG + Intronic
1113617358 13:111690224-111690246 CTGGGCTAGCCTGTGGGGGATGG - Intergenic
1113622887 13:111775494-111775516 CTGGGCTAGCCTGTGGGGGATGG - Intergenic
1113813344 13:113155034-113155056 CTGCGTCATCCCATGGTGGAAGG - Intergenic
1114278079 14:21165887-21165909 CTGTGCTATCCCAGGGAGGAGGG + Intergenic
1114834319 14:26185469-26185491 CTGTGCTTTCCCATGGTAAAAGG - Intergenic
1115736698 14:36339316-36339338 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1116054971 14:39852415-39852437 CTATGTCATCCTATGGGGGAAGG + Intergenic
1117263130 14:54057410-54057432 CTGGGATAGCCTATAGTGGATGG - Intergenic
1118586039 14:67354018-67354040 CTGTGTTATCCCATGGCAGAAGG - Intronic
1120292108 14:82588877-82588899 CTGTGCCCTCATATGGTAGAAGG - Intergenic
1121420982 14:93814062-93814084 CTGTGCTATTCCATGGCAGAAGG + Intergenic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1123632077 15:22268458-22268480 CTGGGACATCCCATGGTGGAAGG - Intergenic
1123950938 15:25274260-25274282 CTCTGTCATCCTATGGTAGAAGG + Intergenic
1124598402 15:31110710-31110732 CTGTGCCCTCCAATGGAGGATGG - Intronic
1125260912 15:37823773-37823795 CTGTGCTCTCCCAAGGTGGAAGG - Intergenic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1126591060 15:50340131-50340153 CTGTGCCCTCATATGGTGAAGGG - Intronic
1127733230 15:61819070-61819092 CTGTGTCATCCCATGGTAGAAGG - Intergenic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1129151408 15:73690545-73690567 CTGCATTATCCTATTGTGGAAGG + Intronic
1129416813 15:75388217-75388239 CTGAGCTATTCTATGGAAGAGGG + Intronic
1130052182 15:80493081-80493103 CTGTGTCATCCCATGGTGGAAGG + Intronic
1130938233 15:88487966-88487988 CTGTGTCATCCCATGGAGGAAGG + Intergenic
1130949810 15:88576897-88576919 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1131610652 15:93958000-93958022 CTGTGTTTTCACATGGTGGAAGG + Intergenic
1132140134 15:99385375-99385397 AAGTGCTATCCTCTGGTAGAGGG - Intronic
1133256460 16:4519536-4519558 CTGTGTCATCCCATGGTGGAAGG - Intronic
1135507962 16:23055445-23055467 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1136252473 16:29014927-29014949 CTGTGTCAGCCCATGGTGGAAGG - Intergenic
1136375601 16:29863404-29863426 CTCTGCTTTCCTTTTGTGGAGGG + Exonic
1136467534 16:30455328-30455350 CTGTGGTAACCTATGGTCAAAGG - Intergenic
1136563223 16:31053529-31053551 ATGTGCTTTCCAATGGAGGATGG - Intergenic
1136720459 16:32315827-32315849 CTGTGTCATCCCATGATGGAAGG - Intergenic
1136725516 16:32354220-32354242 CTGTGTCATCCCATGATGGAAGG - Intergenic
1136838838 16:33522103-33522125 CTGTGTCATCCCATGATGGAAGG - Intergenic
1136843846 16:33560276-33560298 CTGTGTCATCCCATGATGGAAGG - Intergenic
1137423419 16:48355359-48355381 CTGTGTCCTCATATGGTGGAAGG - Exonic
1138208585 16:55143812-55143834 CTGCATCATCCTATGGTGGAAGG - Intergenic
1138694348 16:58797860-58797882 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1139246010 16:65444623-65444645 CTGTATTATCCTATGGTGGAAGG + Intergenic
1140231911 16:73124320-73124342 CTGTGCCTTCATGTGGTGGAAGG + Intergenic
1140554656 16:75907997-75908019 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1140863436 16:79039387-79039409 CTGTGACTTCCTATGGGGGAAGG - Intronic
1141018341 16:80470878-80470900 ATGAGCTTTCCTATGGAGGAAGG + Intergenic
1141777467 16:86133914-86133936 CTGTGCCATCACTTGGTGGAAGG - Intergenic
1203000916 16_KI270728v1_random:163536-163558 CTGTGTCATCCCATGATGGAAGG + Intergenic
1203005973 16_KI270728v1_random:201942-201964 CTGTGTCATCCCATGATGGAAGG + Intergenic
1203132517 16_KI270728v1_random:1699939-1699961 CTGTGTCATCCCATGATGGAAGG + Intergenic
1203149003 16_KI270728v1_random:1822391-1822413 CTGTGTCATCCCATGATGGAAGG - Intergenic
1203154011 16_KI270728v1_random:1860574-1860596 CTGTGTCATCCCATGATGGAAGG - Intergenic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1144007098 17:11110636-11110658 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1144754965 17:17674116-17674138 CTGTATCATCCCATGGTGGAAGG + Intergenic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1148998702 17:51734931-51734953 CTGTGTCATCCCATGGCGGAAGG + Intronic
1149324713 17:55518158-55518180 CTGTGTCATCCCATGGTAGAAGG + Intergenic
1150505468 17:65693881-65693903 CTGTGTCCTCCCATGGTGGAAGG - Intronic
1151617917 17:75226435-75226457 CTGTGTTCTCATGTGGTGGAAGG + Intronic
1151785307 17:76272319-76272341 CTGTGCTTTCCCAGGCTGGAAGG + Intergenic
1152126217 17:78448803-78448825 CTGTGTCATCCCATGGTGGAAGG - Intronic
1152134937 17:78498268-78498290 CTGGTCTATCCTGTGGTGGGAGG + Intronic
1152259446 17:79259254-79259276 CTGTGCTGTCCTCGGGTCGAGGG + Intronic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1152507033 17:80756248-80756270 CTGTGCCATCCCATGGCAGAAGG - Intronic
1153038317 18:785988-786010 CTGTGTTATCTCATGGTGGAAGG - Intronic
1153844252 18:9034095-9034117 CTGTGCTCTCACCTGGTGGAAGG - Intergenic
1154297844 18:13165808-13165830 CGGTGCTGTCCTGTGGGGGATGG + Intergenic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1154505311 18:15033038-15033060 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1155298273 18:24405479-24405501 CTGTGTCGTCCAATGGTGGAAGG - Intergenic
1155510981 18:26576622-26576644 CAGTGCTTTCCTCTGGAGGAAGG - Intronic
1156458660 18:37308910-37308932 CTGTGCTATCTGAGTGTGGAGGG - Intronic
1156666780 18:39418192-39418214 GTGGGCTATACTATGGTGCACGG - Intergenic
1157244527 18:46041578-46041600 CTGTGCTCTCCAAGGTTGGAGGG + Intronic
1157416336 18:47506439-47506461 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1157430096 18:47617515-47617537 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1157543477 18:48530487-48530509 CTGTGTCATCCCATAGTGGAAGG + Intergenic
1158429840 18:57375447-57375469 CTGTGCTTTCCCATGGTGGAAGG - Intergenic
1159488569 18:69099174-69099196 CTGTGCCATGATATGGTAGAGGG - Intergenic
1159829395 18:73255871-73255893 CTGCGTCATCCCATGGTGGAAGG + Exonic
1160924341 19:1536031-1536053 CTGTGCTGCCCTGGGGTGGACGG + Intergenic
1163257823 19:16168255-16168277 CTGGGCAATCCTCTGGCGGAAGG + Exonic
1165521333 19:36316652-36316674 CTGTGCCGTCCTATGGTGGAAGG + Intergenic
1165622728 19:37261936-37261958 CTGTGCCGTCCTATGGTGGAAGG - Intergenic
1165634428 19:37328571-37328593 CTGTGTTGTCCTATGCTGGAAGG - Intronic
1166570827 19:43796049-43796071 CTGTGTTCTCATGTGGTGGAAGG + Exonic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925303156 2:2831123-2831145 CTGGGTCATCCCATGGTGGAAGG - Intergenic
925868404 2:8248386-8248408 CTGTGCTGTCCTATGGAGGAAGG - Intergenic
926538914 2:14150579-14150601 CTGTGCTCTACTATAGTAGAGGG + Intergenic
926589616 2:14726428-14726450 CTGTGTTATCCCATGGTGGAAGG + Intergenic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
928865884 2:35917312-35917334 CTGTGTTCTCCTATGGGAGAAGG - Intergenic
929222961 2:39484365-39484387 CTGTGTTATTCCATGGTGGAAGG - Intergenic
929291109 2:40192960-40192982 CTGTCCTATCCCGTGGCGGATGG - Intronic
930511663 2:52352882-52352904 CTGTGCCATCCCATGGCAGAAGG - Intergenic
930683669 2:54285101-54285123 CTGTGCCCTCATATGGTGGAAGG + Intronic
931726365 2:65115052-65115074 CTGTGTTATCATATGGTGGAAGG - Intronic
931838103 2:66121008-66121030 CTGAGCCATCCTATGGAAGAAGG + Intergenic
932631682 2:73349606-73349628 TTGTGGTATCCTTTGGTGAACGG + Intergenic
932639762 2:73432594-73432616 CTGTGCCCTCCCATGGTGGAAGG + Intronic
933133687 2:78703941-78703963 CTGCATTATACTATGGTGGAAGG - Intergenic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933270544 2:80228336-80228358 CTGTGTTTTCATATGGTGGAAGG + Intronic
933939506 2:87233658-87233680 CTGTGTCATCCCATGGGGGAAGG - Intergenic
934320370 2:91966344-91966366 CTGTGTCATCCCATGATGGAAGG + Intergenic
934945820 2:98540644-98540666 CTGCACCATCCTGTGGTGGAAGG + Intronic
934972530 2:98774812-98774834 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
935441533 2:103103691-103103713 CTGTGGTATCCTGGGGAGGAGGG + Intergenic
936044861 2:109179600-109179622 CTGTGTTGTAATATGGTGGAGGG + Intronic
936592127 2:113814113-113814135 CTGTGTTACCATATGGTGGGAGG + Intergenic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
936785036 2:116084605-116084627 CTGTATTCTCCCATGGTGGAGGG - Intergenic
937448999 2:121984961-121984983 CTGTGTCCTCATATGGTGGAAGG + Intergenic
937951694 2:127392993-127393015 CTGTGTCATCCTGTGGGGGAAGG + Intergenic
938504498 2:131863300-131863322 CTGTGTTATCCCATGGTGGAAGG + Intergenic
938706282 2:133930477-133930499 CTGTGTCCTCATATGGTGGAAGG + Intergenic
939580366 2:143939281-143939303 CTGTGCTATTCTTTGGTGGGTGG - Exonic
940672982 2:156693637-156693659 CTGTGCTCTCACATGGTGGAGGG - Intergenic
940746568 2:157574306-157574328 CTGTGTCCTCTTATGGTGGAGGG + Intronic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941711084 2:168714106-168714128 CTGTGTCTTCGTATGGTGGAAGG + Intronic
942513083 2:176723282-176723304 CTGTGACCTCATATGGTGGAAGG - Intergenic
943204804 2:184880758-184880780 CTGTGTCATCCCATGGTGGAAGG + Intronic
943271975 2:185817112-185817134 CTGTGTTATACTATGCTGGGAGG - Intronic
944085298 2:195839438-195839460 CTCTGGTTTCCTAAGGTGGAAGG - Intronic
944287680 2:197970203-197970225 CTATGTTATCCTATGGTGGGAGG + Intronic
944577783 2:201106248-201106270 CTGTGCCCTCATATGGTAGAAGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
945837959 2:214854662-214854684 CTATGTCATCCCATGGTGGAAGG + Intergenic
946132373 2:217616744-217616766 CTACGTTATCCCATGGTGGAAGG + Intronic
947086976 2:226464580-226464602 GTGTGCTCTCCTCTGCTGGAGGG - Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1169286930 20:4316824-4316846 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1169798936 20:9495628-9495650 CTGTGCTCTTCTATGCTGGTTGG + Intergenic
1170509772 20:17064748-17064770 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170530933 20:17290843-17290865 TTGTGTTAACCCATGGTGGAAGG + Intronic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1171173202 20:23033747-23033769 TGGTGCCATCCTTTGGTGGAAGG - Intergenic
1171336059 20:24386613-24386635 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1173148148 20:40543227-40543249 CTGTGACCTCATATGGTGGAAGG - Intergenic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1173366450 20:42389932-42389954 CTGTGTCATCTTATGGTAGAAGG - Intronic
1173778537 20:45733601-45733623 CTGTGCTCTCACATGGTAGAAGG + Intergenic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1175533549 20:59691072-59691094 CTGAGATATCCTATAGTGGGAGG - Intronic
1176792540 21:13336062-13336084 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1177094072 21:16809393-16809415 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1177701980 21:24651087-24651109 CTATGTCATACTATGGTGGAAGG - Intergenic
1177991947 21:28046946-28046968 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1178023947 21:28443505-28443527 TTGTGTCATCATATGGTGGAAGG - Intergenic
1178053264 21:28770702-28770724 CTGTGTGATCTCATGGTGGAAGG - Intergenic
1178969754 21:37162894-37162916 CTGTGTTTTCTCATGGTGGAAGG + Intronic
1180308615 22:11150400-11150422 CTGTGTCATCCCATGATGGAAGG + Intergenic
1180547092 22:16512211-16512233 CTGTGTCATCCCATGATGGAAGG + Intergenic
1182077332 22:27504107-27504129 CTGTGCTCTCCTACTGTGGTTGG - Intergenic
1182212083 22:28685130-28685152 CTGTGTCATCCCATGATGGAAGG - Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1182856406 22:33521376-33521398 CTGAGCTATCCTATGCTAGCAGG - Intronic
1184007149 22:41718797-41718819 CTCTGTCATCCCATGGTGGAAGG + Intronic
1184449004 22:44571753-44571775 CTCTGCTGTGCTATGGTGTAAGG - Intergenic
1184622580 22:45693455-45693477 CTTTGTTCTCCTGTGGTGGAAGG + Intronic
1184625119 22:45720906-45720928 CTGTGTTATCCCATGGTGGGAGG + Intronic
1184724013 22:46332503-46332525 CGGTGCCATCCTATGGAGAAAGG - Intronic
1184963668 22:47950672-47950694 CTGTGGGATCCCATGCTGGAGGG - Intergenic
1185216835 22:49605612-49605634 CTGTGTCAGCCCATGGTGGAAGG - Intronic
1185235630 22:49711127-49711149 CTGTGTCTTCCTGTGGTGGAAGG + Intergenic
950503439 3:13378347-13378369 CTGTGGTATCCTGTGTTGCAGGG - Intronic
951066766 3:18276033-18276055 CTGTGTTCTCATATGCTGGAAGG - Intronic
951391872 3:22114908-22114930 CTGTGCTTTCACATGGTGGAAGG - Intronic
951686940 3:25354907-25354929 CTGTGTTATGCTATGCTGGATGG - Intronic
952707002 3:36389338-36389360 CTGTGTTGTCTCATGGTGGAAGG + Intronic
953206706 3:40837682-40837704 CTGTGTTCTCATATGGTGGAAGG + Intergenic
953467039 3:43131170-43131192 CTGTGCTATACCATGGCAGAAGG + Intergenic
954010671 3:47634518-47634540 ATGTGGTATCCTATAATGGAAGG + Intronic
954320522 3:49829499-49829521 CTGTCCTTACCTAGGGTGGAAGG + Exonic
954898240 3:53995912-53995934 CTGTGTCTTCCCATGGTGGAAGG - Intergenic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955360004 3:58265769-58265791 CTGTGTCATCCCGTGGTGGAAGG + Intronic
957114339 3:76005053-76005075 CTGTGCCATCTCATGGTGGAAGG - Intronic
957439546 3:80225933-80225955 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
957643505 3:82888329-82888351 CTGTGTCATCTTGTGGTGGAAGG + Intergenic
957781909 3:84829539-84829561 CTGTATCATCCCATGGTGGAAGG + Intergenic
957863981 3:85998720-85998742 CTGTGATATAGTATGATGGATGG + Intronic
958555821 3:95674580-95674602 ATGCTTTATCCTATGGTGGAAGG + Intergenic
959151330 3:102611877-102611899 CTGTGTTATAACATGGTGGAAGG + Intergenic
959433308 3:106282674-106282696 CTGTGGCTTCCAATGGTGGAAGG - Intergenic
959654536 3:108786988-108787010 CTGAGCTTTCCTTTGTTGGAAGG - Intergenic
960154668 3:114287108-114287130 CTGTGTTTTCACATGGTGGAAGG + Intronic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
960772064 3:121205292-121205314 CTGTGTTATAACATGGTGGAAGG + Intronic
960859391 3:122136061-122136083 CTGTGTCATCCCATGGTGGAAGG + Intergenic
961060177 3:123822084-123822106 CTGTGTCATCCCACGGTGGAAGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962587342 3:136855486-136855508 CTGTGCTAACCAAAGCTGGATGG - Exonic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
964102248 3:153001307-153001329 CTGTGTCATCCCATGGTGGAAGG + Intergenic
964340864 3:155707078-155707100 CTGTGTTCTCATATGGTGGAAGG - Intronic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
965403974 3:168248666-168248688 CTGGGCTGTCCTTTGTTGGAGGG + Intergenic
967039930 3:185682397-185682419 GAGGGTTATCCTATGGTGGAAGG - Intronic
967697027 3:192543914-192543936 CTATCCTCTCCTAAGGTGGAGGG + Intronic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
969104792 4:4797526-4797548 CTGGGTCATCCCATGGTGGATGG + Intergenic
969283472 4:6187574-6187596 CTGTGTTTTCACATGGTGGAAGG - Intronic
970376963 4:15468576-15468598 CTGCACCATCCTATGGTGCAAGG + Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
971770508 4:30889697-30889719 CTGTGGTCTCATATGGTGTAAGG + Intronic
971906491 4:32732678-32732700 TTTTGCTGTCCTTTGGTGGAGGG - Intergenic
971952035 4:33363890-33363912 CTTTGGTATCCAATGGTGGGGGG + Intergenic
974351752 4:60756485-60756507 CTGGGCTTTCCTTTGGTGGGAGG + Intergenic
974926714 4:68308418-68308440 CTGTGCTATTCTTGGTTGGAAGG + Intergenic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
977119528 4:93080894-93080916 CTGTGTCATCCTATGGAGGAAGG + Intronic
977263097 4:94822123-94822145 CTGTGTCATCTCATGGTGGAAGG + Intronic
977320125 4:95503254-95503276 CTGTGTTATTCCATGGTGAAAGG - Intronic
977653973 4:99500959-99500981 CTGTGCCTTCACATGGTGGAAGG + Intergenic
977706778 4:100080428-100080450 CTGTGCCATCCAATGGCAGAAGG + Intergenic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
979206485 4:118044771-118044793 CTGTGTCATCTCATGGTGGAAGG + Intronic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
979860366 4:125686100-125686122 CTGTGTCATCCGATGGTGAAAGG + Intergenic
980114527 4:128666494-128666516 CTGAGCCATCACATGGTGGAAGG + Intergenic
980123624 4:128752382-128752404 CTATGTTATCCCATGGCGGAAGG - Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
982497602 4:156110314-156110336 GTGCATTATCCTATGGTGGAAGG - Intergenic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
983155472 4:164341631-164341653 CTGTGTCATCATGTGGTGGAAGG + Intronic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983860439 4:172699084-172699106 CTGTGCTTCCACATGGTGGAAGG + Intronic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
984753258 4:183299132-183299154 CTGTGTCATCCCATGGTGGAGGG + Intronic
984789213 4:183599431-183599453 CTGTGTCATCCTGTGGTGGAAGG - Intergenic
986057587 5:4154027-4154049 CTGTGTTCTCCTGTGGTGGAAGG - Intergenic
986183981 5:5419430-5419452 CTGGGGCATCCTAGGGTGGAAGG - Intergenic
986748919 5:10767695-10767717 GTGTGTCATCCCATGGTGGAGGG - Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
987331189 5:16859301-16859323 CTGTGCCCTCATGTGGTGGAAGG + Intronic
987354060 5:17046743-17046765 CTGTGTTCTCCCATGTTGGAAGG - Intergenic
987738076 5:21870458-21870480 CTGTGCTATCCTATGGTGGAAGG - Intronic
988580220 5:32462240-32462262 CTGCGCCATCACATGGTGGAAGG - Intergenic
989382394 5:40822269-40822291 CTGTGTCCTCATATGGTGGAAGG + Intergenic
990055517 5:51572344-51572366 CTGTGTCCTCCGATGGTGGAAGG + Intergenic
990700167 5:58466505-58466527 CTGTGGTCTCACATGGTGGAAGG - Intergenic
991321845 5:65382977-65382999 CTGTGTTCTCATATGGTGAAAGG + Intronic
991929051 5:71733624-71733646 CTGTGTCCTCATATGGTGGAAGG + Intergenic
992037154 5:72791171-72791193 CTGTGTTATCCCATGGTAGAGGG + Intergenic
993121400 5:83779190-83779212 CTGCGTCATCCCATGGTGGAAGG + Intergenic
993222624 5:85120591-85120613 TTGTGCTCTCATATAGTGGAAGG - Intergenic
995506980 5:112870793-112870815 CTGTGTGATCCCATGGTGGAAGG - Intronic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
996701471 5:126454354-126454376 CTGTGCGTTCCAAGGGTGGAAGG + Intronic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
997502506 5:134387620-134387642 CTGTGACATCCCATGGTGGAAGG + Intronic
997841176 5:137241672-137241694 CTGTGCCATCCCATGGCTGAAGG - Intronic
998204571 5:140149538-140149560 CTGAGCCAGCCTATGGTGGGTGG - Intergenic
998520912 5:142799685-142799707 CTGTGTCATCCCATGTTGGAAGG + Intronic
1000049222 5:157547508-157547530 CTATGCTACCCCATGGTGAAAGG - Intronic
1000545207 5:162591617-162591639 CTGCTTTATCCCATGGTGGAAGG - Intergenic
1000939835 5:167347258-167347280 CTGTGCTTTGCTATGGTAGAAGG + Intronic
1001191275 5:169634049-169634071 CTGTGCCATCCCGTGGTGGAAGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001838547 5:174853295-174853317 CTTTGCCATACTATGGAGGAAGG + Intergenic
1003263109 6:4541155-4541177 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1003660470 6:8056076-8056098 CTATGTCATCCTATGGTGGGAGG - Intronic
1004039881 6:11965100-11965122 CTGCATCATCCTATGGTGGAAGG + Intergenic
1004383887 6:15155532-15155554 CTGTGTCATCCCACGGTGGAGGG - Intergenic
1004784906 6:18957385-18957407 ATGGGCTAGCCTATGGAGGAGGG + Intergenic
1004981286 6:21027654-21027676 CTGTATCATCCTGTGGTGGAGGG - Intronic
1007280631 6:40709781-40709803 CTGTGTCATCCTATAGTGGAAGG + Intergenic
1008636019 6:53411943-53411965 TTGTGTCATCCTATGGTGGAAGG + Intergenic
1010006974 6:71006257-71006279 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1011567648 6:88694851-88694873 CTGGGCCATGCTGTGGTGGAAGG - Intronic
1011935470 6:92771072-92771094 CTGTGCCAGCTCATGGTGGAAGG - Intergenic
1011943657 6:92873827-92873849 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1012411381 6:98961898-98961920 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1013893944 6:115062380-115062402 CTGAGCTATTCTTTGCTGGAAGG + Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014127097 6:117789318-117789340 CTGTGATCTCACATGGTGGAAGG + Intergenic
1014335311 6:120126422-120126444 CTGTGTCATCATGTGGTGGAAGG + Intergenic
1016193255 6:141297367-141297389 CTGTGTTATCATACGATGGAGGG + Intergenic
1016512023 6:144853948-144853970 CTGCGTCATCCTATGGTGGAAGG - Intergenic
1017681480 6:156868565-156868587 CTGTGTCCTCCTATGGTGGAAGG + Intronic
1018644600 6:165935838-165935860 CTGTGTCATCCCATGGTGGAAGG - Intronic
1022525696 7:31035628-31035650 CTGTGTCCTCCTGTGGTGGAAGG + Intergenic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1022686854 7:32605239-32605261 CTGTCTCATCCCATGGTGGAAGG + Intergenic
1023104735 7:36752521-36752543 GTGTGTTATCCCATGGTGGAAGG + Intergenic
1023823344 7:43992265-43992287 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1024202046 7:47117605-47117627 CTGTGTTGTCCCATGGTGGAAGG - Intergenic
1024978791 7:55138886-55138908 CTGTGTCAATCTATGGTGGAAGG + Intronic
1025002612 7:55329684-55329706 CTGTGTCATCCCGTGGTGGAAGG + Intergenic
1025603112 7:63017873-63017895 ATGTGATATCCAATGGTGGGGGG - Intergenic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1027778536 7:82495943-82495965 CTGTATCAACCTATGGTGGAGGG + Intergenic
1028210581 7:88069274-88069296 CTGTGTCATCATATGGTAGAAGG - Intronic
1028414529 7:90566027-90566049 CTGTGACCTCATATGGTGGAAGG - Intronic
1028518045 7:91699189-91699211 TTTGGCTATCCTTTGGTGGAGGG - Intronic
1029572769 7:101381566-101381588 CTGTGTCATTTTATGGTGGAAGG + Intronic
1029751604 7:102545717-102545739 CTGTGTCCTCATATGGTGGAAGG + Intronic
1029769557 7:102644808-102644830 CTGTGTCCTCATATGGTGGAAGG + Intronic
1030206968 7:106960435-106960457 CCGTGTTGTCCCATGGTGGAAGG - Intergenic
1031146693 7:118004709-118004731 CTGTTTTATACTATGCTGGATGG + Intergenic
1031418062 7:121517144-121517166 CTGTGTTAGCTCATGGTGGAAGG + Intergenic
1032531852 7:132627687-132627709 CTGTGCCTTCACATGGTGGAAGG - Intronic
1032571229 7:133000881-133000903 CTGTGCTGTCCTATGGTCACAGG - Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1033616823 7:143024329-143024351 CTGTGTCATCCTATGGCAGAAGG - Intergenic
1034826370 7:154268423-154268445 CTGTATTCTCATATGGTGGATGG + Intronic
1034996829 7:155582618-155582640 ATGTGCTCTCACATGGTGGAAGG - Intergenic
1036290204 8:7481283-7481305 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1036331273 8:7830237-7830259 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1036535194 8:9643337-9643359 CTGTGTCATCCCATGGTGGAAGG + Intronic
1036945021 8:13087080-13087102 CTGTGTCATCCCATAGTGGAAGG - Intronic
1037363169 8:18095306-18095328 CTGTGTTCTCCTCTGGTAGAAGG - Intergenic
1038153641 8:24965992-24966014 CAGAGCTATCCAAAGGTGGAAGG + Intergenic
1038725296 8:30076781-30076803 CTGTGTCATCCCATGGTGGAAGG - Intronic
1039094482 8:33868723-33868745 CTGTGTCATCCCATGATGGAAGG + Intergenic
1041128937 8:54675974-54675996 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1043168268 8:76931958-76931980 CTGTGCTATCTTTGGGTAGAGGG + Intergenic
1044164824 8:88968508-88968530 CTGTGTCATCCCATGATGGAAGG - Intergenic
1044184117 8:89231820-89231842 CTGTGCCCTCATATGGTGGGAGG + Intergenic
1044478547 8:92657124-92657146 CTGTGCTCTCATATGTTGTAAGG - Intergenic
1044567751 8:93683353-93683375 CTGTATCATCCTACGGTGGAAGG - Intergenic
1044608886 8:94072606-94072628 CTTGGCAATTCTATGGTGGATGG - Intergenic
1044617022 8:94152780-94152802 CTGTGTTATCCTATGACAGAAGG + Intronic
1044719140 8:95129021-95129043 CTGTGTTCTCATGTGGTGGAAGG + Intergenic
1045407620 8:101882389-101882411 CTGTATCCTCCTATGGTGGAAGG - Intronic
1045512158 8:102820252-102820274 TTGTGTCATCCCATGGTGGAAGG - Intergenic
1045655863 8:104385819-104385841 CTGTGTCATCCCATGGAGGAAGG - Intronic
1045683223 8:104684777-104684799 CTGTGTCATCCTATGGCTGAAGG + Intronic
1046157535 8:110312701-110312723 CTGTGTCATCCCATGGTGAAAGG - Intergenic
1047638039 8:126787462-126787484 CTGTGTCCTCCCATGGTGGATGG - Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1048385421 8:133908061-133908083 CTGTGTCATCCCATTGTGGAAGG + Intergenic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1049493705 8:142918297-142918319 CAGTGCGCTCCTGTGGTGGAGGG - Intergenic
1049722644 8:144126690-144126712 CTGTGCTTTCCTTTGGAGGATGG + Intergenic
1050161383 9:2723029-2723051 CAGTGCCCTCCTATGGTGGGTGG - Intronic
1052300090 9:26944197-26944219 CTGTATCATCCTATGGTGGAAGG - Intronic
1053049327 9:34945701-34945723 CTGTGTTATAACATGGTGGAAGG - Intergenic
1053167421 9:35854304-35854326 CTGTGCTGTGCTGTGGAGGAGGG + Exonic
1055924847 9:81499443-81499465 CTGTGCTCTCCAATAGGGGAAGG - Intergenic
1056516107 9:87351900-87351922 CTGTGTCTTCCCATGGTGGAAGG - Intergenic
1056854004 9:90109302-90109324 CCATGGTATCCCATGGTGGAAGG + Intergenic
1057193820 9:93103759-93103781 CTGTGTTATCCCATGGTGGAAGG + Intronic
1057974629 9:99591854-99591876 AAGTGCTTTTCTATGGTGGAAGG - Intergenic
1058956199 9:109951006-109951028 CTGTGATATCCTATTCTGGCAGG + Intronic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1059857625 9:118417653-118417675 CTGCACCATCCCATGGTGGAAGG - Intergenic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1060835334 9:126751423-126751445 CTGTGCAAGACTGTGGTGGATGG + Intergenic
1060937444 9:127523889-127523911 CTCTGACATCCTCTGGTGGAGGG - Intronic
1061641579 9:131961724-131961746 CTGTGCTACCCTAAGTGGGAAGG - Intronic
1061785666 9:133026522-133026544 CTGTGCCATAACATGGTGGAGGG + Intergenic
1062483792 9:136764359-136764381 CTCTGCTGTCCTGTGGTGGGTGG - Intronic
1062589837 9:137268677-137268699 CTGTGTCATCCCATGGTGGAAGG + Intronic
1185513568 X:681035-681057 CTGTGCTCTCATGTGGTGGAAGG + Intergenic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186236828 X:7521102-7521124 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1186939770 X:14492946-14492968 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1186987056 X:15028489-15028511 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1186989499 X:15052156-15052178 CTGTGTCATCCCATGGTAGAAGG + Intergenic
1187365397 X:18662059-18662081 CTGTGCCCTCCCATGGCGGAAGG - Intronic
1187372827 X:18724883-18724905 TAGTGCTGTCCTGTGGTGGATGG + Intronic
1188128259 X:26398327-26398349 CTGTGCCATCCCATGGCAGAAGG - Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188520075 X:31029146-31029168 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1188753539 X:33932919-33932941 CTGTGTTATCCCATGGTGAAAGG + Intergenic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1188890183 X:35601643-35601665 CTGTGTTATCCAGTGGTGGAAGG + Intergenic
1188965361 X:36545044-36545066 GTGTTATATCCTATGTTGGATGG - Intergenic
1189390681 X:40573953-40573975 CTGTGCTATCCCATGGCAGAAGG - Intergenic
1189489404 X:41458027-41458049 CGGCGCCATCCCATGGTGGAAGG + Intronic
1189721940 X:43928824-43928846 CTGCGTCATCCCATGGTGGAAGG + Intergenic
1193902284 X:87196069-87196091 CTATGTCATCCCATGGTGGAAGG - Intergenic
1193963108 X:87949147-87949169 CTGTGCTAAGCTGTGGAGGAAGG - Intergenic
1193967888 X:88011000-88011022 CTGTGTTATCCCATGGTGGGAGG + Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1194633248 X:96312391-96312413 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1194759259 X:97774935-97774957 CTGTGTCATCCTATGGCGGAAGG - Intergenic
1196390128 X:115198438-115198460 CTGTGCTACACTATGGTCGTGGG + Intronic
1196661249 X:118271918-118271940 CTGTGCTATCTTATGGCAGCTGG + Intergenic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1199208289 X:145174912-145174934 CTGCGCCCTCATATGGTGGAAGG - Intergenic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1201933968 Y:19386286-19386308 TTTTGCTATCGTTTGGTGGAAGG + Intergenic