ID: 987738468

View in Genome Browser
Species Human (GRCh38)
Location 5:21874686-21874708
Sequence CTGTGAACAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 3, 2: 20, 3: 132, 4: 424}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987738468_987738474 13 Left 987738468 5:21874686-21874708 CCATCCACCACTGCTGTTCACAG 0: 1
1: 3
2: 20
3: 132
4: 424
Right 987738474 5:21874722-21874744 GCCATTGATTTCCACCCTTCTGG 0: 1
1: 0
2: 8
3: 45
4: 192
987738468_987738479 23 Left 987738468 5:21874686-21874708 CCATCCACCACTGCTGTTCACAG 0: 1
1: 3
2: 20
3: 132
4: 424
Right 987738479 5:21874732-21874754 TCCACCCTTCTGGGGTAGAAGGG No data
987738468_987738478 22 Left 987738468 5:21874686-21874708 CCATCCACCACTGCTGTTCACAG 0: 1
1: 3
2: 20
3: 132
4: 424
Right 987738478 5:21874731-21874753 TTCCACCCTTCTGGGGTAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 128
987738468_987738477 15 Left 987738468 5:21874686-21874708 CCATCCACCACTGCTGTTCACAG 0: 1
1: 3
2: 20
3: 132
4: 424
Right 987738477 5:21874724-21874746 CATTGATTTCCACCCTTCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 191
987738468_987738476 14 Left 987738468 5:21874686-21874708 CCATCCACCACTGCTGTTCACAG 0: 1
1: 3
2: 20
3: 132
4: 424
Right 987738476 5:21874723-21874745 CCATTGATTTCCACCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987738468 Original CRISPR CTGTGAACAGCAGTGGTGGA TGG (reversed) Intronic
900297451 1:1959052-1959074 CTGGGAACCCCAGTGGGGGACGG - Intronic
900561500 1:3309277-3309299 CTGGGAACACTAATGGTGGAGGG + Intronic
901101506 1:6722606-6722628 TTCTGAATAGGAGTGGTGGAGGG + Intergenic
901685931 1:10943331-10943353 CTGTGAGCAGCAGAGGTGTTGGG + Intergenic
902188391 1:14742786-14742808 CTGTGGACAGCCATGGTGGCAGG + Intronic
902839856 1:19067865-19067887 TTGTGGACAGAAGGGGTGGATGG + Intergenic
903273971 1:22209091-22209113 ATGTGCCCAGCAGGGGTGGATGG + Intergenic
903562379 1:24237435-24237457 GTGGGGACAGCAGTGTTGGATGG + Intergenic
904295591 1:29517847-29517869 CTGGGAGCAGCAGGTGTGGATGG + Intergenic
905289284 1:36910552-36910574 CTCTCAGCAGCAGTGGTGGGGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908237870 1:62164789-62164811 CTGTGAACAGGGGTTGGGGAAGG - Intergenic
908475964 1:64488968-64488990 CTGGGAACAGCAGGGGATGAGGG + Intronic
908523112 1:64964038-64964060 CATTGAACAGGAGTGTTGGAAGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908795960 1:67832264-67832286 CTCTGAACACCAGAGGTAGAAGG - Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910452464 1:87360945-87360967 CTTTGAACACCAGAGGTGGAGGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
913223629 1:116679535-116679557 CTGAGGACAGCTGTGGGGGAAGG + Intergenic
915717907 1:157961816-157961838 CTGTGAAGAGCAAAGCTGGAGGG + Intergenic
917159166 1:172038121-172038143 CTCTGAAGGGCAGTGGAGGAGGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917659915 1:177167456-177167478 CTGTGACCAGCAGGGGTGAGCGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
918509951 1:185300989-185301011 CTGGGAACAGCAGAGATGAATGG - Exonic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922801863 1:228368153-228368175 TTGTGAACCTCAGTGGGGGAGGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1062944802 10:1452067-1452089 CTCTGACCAGCAGGGGTGCATGG - Intronic
1063464161 10:6232316-6232338 CTGTGATCAGAAGTGGGGCAGGG + Intronic
1063892267 10:10642788-10642810 CTGTGGACAGCAGTGGGTGCAGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1067063493 10:43090157-43090179 CTGTGAACAGCTGTGTTTGGTGG + Intronic
1067748130 10:48951974-48951996 CTGTTACCAGCAGTGGGGAAGGG + Intronic
1067777588 10:49174692-49174714 GTGTGCAAAGCAGTGGTGGGGGG + Intronic
1068178778 10:53495264-53495286 CTGAGAAAAGCAATGGGGGAAGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070286047 10:75084735-75084757 CTCAGAACAGCAGTGGGGGGAGG - Intergenic
1070727801 10:78803921-78803943 CTGAGGCCAGCAGTGGTGGCAGG - Intergenic
1070755270 10:78988109-78988131 CTGAGAACAGCAGTGGAGCCTGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071119312 10:82259682-82259704 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072253405 10:93599831-93599853 CTGTGAAAATCAGATGTGGAGGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073051014 10:100667530-100667552 CTGTGACCATCAGTGGGGAAAGG - Intergenic
1073132588 10:101199572-101199594 CTGGGAAGAGTAGTGGTTGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076835207 10:133017443-133017465 CTGTGAACGGAAGTGGTGTGTGG - Intergenic
1077047643 11:553466-553488 CCGTGACCTGCAGGGGTGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081900898 11:46626994-46627016 CTGTGGAAAGCCGAGGTGGATGG + Intronic
1082737600 11:56873900-56873922 CGATGATCGGCAGTGGTGGATGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083320758 11:61845083-61845105 CTGTGACCAGCAGTGCTGGGTGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1086123070 11:83320588-83320610 CTGGGAAGGGCAGTGGTGGTTGG - Intergenic
1086431452 11:86740639-86740661 GTATGAACAGCAGAGGTGCAAGG + Intergenic
1086661435 11:89423808-89423830 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1089972244 11:122703460-122703482 TTTTGAAAAGCGGTGGTGGAGGG - Intronic
1090957990 11:131530705-131530727 CTTAGAACAGCTGTGCTGGAGGG + Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092470438 12:8773629-8773651 TTGTCAACAGCAGTGCTGGCTGG - Exonic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097787419 12:63776886-63776908 CTGTGAAGAGTAGTGGGGGCAGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098544216 12:71693631-71693653 CTGTGAATAGCAGTAGTGGAAGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1102366797 12:112344442-112344464 TTTTGAACAGAAGTGTTGGATGG - Intronic
1102421545 12:112807311-112807333 CTGTGAAGAGGAGTGGAGGGTGG - Intronic
1102612880 12:114128130-114128152 CTGTGAACAGTTGTGATGAAGGG + Intergenic
1102955898 12:117058898-117058920 CTGTGAAAGGCAGGGGAGGAGGG - Intronic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1103645585 12:122389851-122389873 CTGTCAACACCAGTGCTGGAGGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104273990 12:127308250-127308272 CTGTGGACATCAGCAGTGGATGG - Intergenic
1104745037 12:131205177-131205199 CTGTGAAGATGAGTTGTGGATGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109312972 13:60717091-60717113 CTGGGAAGAGCAGGGATGGATGG + Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110718184 13:78731376-78731398 CTATGAAAAGCAGTGGAGGCCGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112049979 13:95635644-95635666 CTGTGTACAGCACTGGAGAAAGG + Intronic
1112363958 13:98741290-98741312 CTATGAAGAGCAGTTGAGGATGG - Intronic
1112751599 13:102589106-102589128 ATGTGAGCAGAAGTGATGGAAGG + Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113799506 13:113079038-113079060 CTGTGAATGGCAGTGGCGGGTGG - Intronic
1114222333 14:20707997-20708019 CTATGAGCAGGAGTGGTGCAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116799715 14:49429844-49429866 CTGTGAGAAGCAGGGGTGGGTGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118134026 14:63001782-63001804 GTGAGAGCAGCAGTGGTTGAGGG - Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1118882946 14:69843962-69843984 CTGTGACCAGCAGTGGAGCTGGG + Intergenic
1118990095 14:70790164-70790186 CCCTGAGCAGCAGTGGGGGAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119230371 14:72974744-72974766 CTGGGAGCTGCAGGGGTGGAGGG - Intronic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121877251 14:97464585-97464607 CTTTGAACAGCAGTATTGCATGG - Intergenic
1122076544 14:99238574-99238596 CTGTGAACCACGGAGGTGGAGGG + Intronic
1123058256 14:105582526-105582548 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123082344 14:105701451-105701473 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125507267 15:40274059-40274081 CTGGTGGCAGCAGTGGTGGAGGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127285220 15:57526845-57526867 CTGTGCTGAGCAGTGGAGGAGGG + Intronic
1127646593 15:60964877-60964899 CTGGGAGAAGCAGTGGTGCAGGG + Intronic
1127887435 15:63214580-63214602 CTTTGAGAAGCCGTGGTGGATGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1129733673 15:77946994-77947016 CTTTGAAAAGCAGTAGTGTAGGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129996118 15:80007743-80007765 CTGAGAACAGCAGTGTAGCATGG - Intergenic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132347311 15:101116132-101116154 CTGAGAACAGTGGTGGGGGAAGG - Intergenic
1132541987 16:514429-514451 CTGGGAACAGCAGGGGCGGGTGG + Intronic
1132753513 16:1470595-1470617 CACTGAACAGCAATGCTGGAGGG + Intronic
1133832183 16:9333349-9333371 ATTTGAAAAGCTGTGGTGGATGG + Intergenic
1134240601 16:12503168-12503190 CTCAGAGCAGCAGTGGTGGGTGG - Intronic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141564230 16:84890656-84890678 CTGTGGGAAGCAGTGGTGGGTGG + Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141757022 16:85998034-85998056 CTGTGATCAGCAGTGATGGCAGG + Intergenic
1142197812 16:88746787-88746809 CTTTAATCAGCAGTGGGGGAAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144669846 17:17126738-17126760 CAGTGCACAGATGTGGTGGATGG + Exonic
1145305244 17:21670456-21670478 CTTGGAACAGCACTGGGGGATGG + Intergenic
1146938453 17:36826923-36826945 CTGTGAAGAGGAGGGGAGGAAGG - Intergenic
1146972443 17:37083721-37083743 CTGTGAAGAGCAGCAGTGGGAGG + Intergenic
1147491189 17:40867734-40867756 CTGTGAAATGCACTGGTGAAAGG + Intergenic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148995522 17:51706006-51706028 CTGTGTAGCGCAGTGGTTGAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151236871 17:72726997-72727019 CTGTGCACAGCAGAGGAGGCTGG - Intronic
1151527481 17:74680939-74680961 ATGTGAACAGGGGTGGTGGTGGG - Intronic
1151664992 17:75540659-75540681 CTGTGGGTAGCAGTGATGGATGG - Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1153171305 18:2319095-2319117 CTGGGAACATCATTGGTGTAGGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153701085 18:7693873-7693895 CTATGAACAGGAGTAGGGGAAGG + Intronic
1155520986 18:26668895-26668917 CTGTGAACTGCAGTGAAGGCAGG + Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1155783051 18:29863416-29863438 CTGTGAAAAACAGTGGCAGAAGG - Intergenic
1156114203 18:33767413-33767435 TTGTGAATAGCAGTGGGGAAAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157531537 18:48425238-48425260 CTGGGAGCAGCCCTGGTGGATGG + Intergenic
1157566253 18:48680937-48680959 CTGGGAGCAGTGGTGGTGGAGGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160564757 18:79780143-79780165 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564778 18:79780248-79780270 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564799 18:79780353-79780375 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564820 18:79780458-79780480 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1161451617 19:4349404-4349426 CTGTGGAAAGCAGTGGTGGCGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164451248 19:28367080-28367102 CTGTGAGCAGCATGGGTGGATGG + Intergenic
1164557686 19:29266277-29266299 CTGGCAACAGCAGCAGTGGAGGG - Intergenic
1165022173 19:32934221-32934243 CTGTGAAGAGCAGGTGGGGATGG + Intronic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1166046579 19:40233952-40233974 CTGTGGGCGGCAGAGGTGGATGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168467264 19:56613227-56613249 CTGTGAAGAGAACTGGTGGTTGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925302791 2:2828901-2828923 CTGTAGGCAGCAGTGCTGGAAGG - Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
925504784 2:4549833-4549855 CCGTGAACATCCGTGGTGGGAGG - Intergenic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928246004 2:29627479-29627501 GTGTGAACAGCAGTGGGCCAGGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929597315 2:43184353-43184375 ATGAGACCAGCAGTGATGGAAGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930936194 2:56955148-56955170 CTGAGAACAGCAGGGAAGGAGGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932463417 2:71897892-71897914 CTGAGAACAGCATTAGTGCAGGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934039921 2:88119344-88119366 CTGGGAACAGAACTGGTGGGAGG - Intergenic
934624283 2:95834496-95834518 CTGAGAACAGCAGGGGCGGGTGG + Intergenic
934690823 2:96357573-96357595 CTGTGAACTCCAGAGGTAGAAGG - Intronic
934809520 2:97267836-97267858 CTGAGAACACCAGGGGTGGGTGG - Intergenic
934911425 2:98258866-98258888 CATTGAATAGCAGTGGTGAAAGG + Intronic
934926266 2:98383600-98383622 CTGTGGACAGAAGTCGGGGAGGG + Intronic
934949709 2:98567819-98567841 TTGTGGACACCAGGGGTGGATGG + Intronic
935111538 2:100098929-100098951 CTGTGGGCAGCAGTGGGGAAGGG - Intronic
935605670 2:104970207-104970229 CAGTGAGCAGCAGGGGTTGAAGG + Intergenic
935621751 2:105136009-105136031 CTGTGACTAGCAATGGTGGTAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936123430 2:109766235-109766257 CTGTGGGCAGCAGTGGGGAAGGG + Intergenic
936221255 2:110605229-110605251 CTGTGGGCAGCAGTGGGGAAGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937128047 2:119486863-119486885 CTGTGGGCAGCCGTGGAGGATGG + Intronic
937559298 2:123201676-123201698 CTGGGAAGAGTAGTGGAGGAGGG - Intergenic
937577451 2:123441204-123441226 ATGGGAAGAGCAGTGGGGGAAGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
938016810 2:127874052-127874074 ATGTGGACAGCAGCAGTGGACGG - Exonic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940233084 2:151479112-151479134 CTGTGAACTGCGCTGGTAGATGG + Exonic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943162702 2:184275920-184275942 ATGTGAAGAGCAGAGGTAGAAGG - Intergenic
946929140 2:224655437-224655459 CTGTGGCCAGCAGCTGTGGAGGG + Intergenic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
948489805 2:238305282-238305304 CAGTGAGTAGCAGTGGTGGCAGG - Intergenic
1170374939 20:15689949-15689971 TTGTGATCAGCAATGGTGAATGG - Intronic
1170608220 20:17889799-17889821 CTGTGCCCAGCTGTGGTGGGTGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172230121 20:33330762-33330784 CTGTAAACAGCAGAGCAGGAGGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1173619136 20:44423406-44423428 GTGTGGTCAGCAGTGATGGAGGG + Intronic
1174227486 20:49013876-49013898 CTTTGAAAAGCACTGGTGGCAGG + Exonic
1175477288 20:59285841-59285863 CCGTGCACAGCAGTGGCAGAGGG + Intergenic
1175650176 20:60715134-60715156 CTTTGGAAAGCAGAGGTGGAAGG - Intergenic
1175730154 20:61348982-61349004 CTGGGAATAACAGTGGTGGTGGG + Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178423576 21:32461111-32461133 CTGAGAACTGCAGGGATGGAGGG + Intronic
1178744773 21:35238254-35238276 GCATGAACAGCAGGGGTGGAGGG + Intronic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1178830364 21:36051222-36051244 TTGTCAACAGCAGTGCTGGCTGG - Intronic
1178899665 21:36588931-36588953 CTGGGAAAAGCAGTGGCGGGAGG - Intergenic
1178940582 21:36901963-36901985 CTGTGGACAGCAGTGGGGGGCGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179786753 21:43734612-43734634 CTGTTAACAGCAGTGCTGCAGGG + Intronic
1180192233 21:46171001-46171023 CTGTGAACATCCTTTGTGGATGG + Intronic
1182520666 22:30882832-30882854 CTGTGAACAGCAAAGGTAGGAGG + Intronic
1183329537 22:37211987-37212009 CTGTGGACAGCCGTGGCCGAGGG - Exonic
1183475923 22:38035726-38035748 CTGGGAACAGCAGAAGAGGAGGG + Intronic
1183700363 22:39447733-39447755 CTGGGAGGAGAAGTGGTGGAGGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
1184745473 22:46453188-46453210 CTGTGCACAGCAGGGCTGGAAGG + Intronic
1184838039 22:47035616-47035638 CTGAGGACAGCAGTGGTTTAGGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952629826 3:35453161-35453183 CTATCAGCAGCAGGGGTGGATGG - Intergenic
952642715 3:35616865-35616887 CTGTGAACAGAAGTGCTGTGTGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953105231 3:39871446-39871468 CTTTGAACAGCAGAGTGGGATGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953627183 3:44580701-44580723 CAGTGCACAGATGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956284028 3:67589715-67589737 CTGTGTGCAGGAGAGGTGGATGG + Intronic
956505111 3:69929544-69929566 CTGTGAATAGCATTGATGTAGGG + Intronic
956859343 3:73307099-73307121 ATGTGAACAGCAGTTGGGGCTGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960520070 3:118644422-118644444 ATGAGAACAGCAATGGGGGATGG + Intergenic
961183794 3:124897192-124897214 CTGTCAACAGTAGTTCTGGAAGG - Intronic
962661828 3:137609362-137609384 CTGTGAACAGCAGTTTGTGAGGG - Intergenic
962748465 3:138415435-138415457 CTGTGAATAGCTGAGGTGGGAGG - Intergenic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963459562 3:145591560-145591582 CTGGGAAGAGCAGTGGGGGTGGG + Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965810796 3:172589982-172590004 ATGAGAACAGCACTGGTGGGGGG - Intergenic
966470819 3:180286854-180286876 CTGTGACCAGCATAGGTTGATGG - Intergenic
966769856 3:183494079-183494101 CTCTGACCAGCAGTTGTGAAAGG + Exonic
966885079 3:184373024-184373046 CTGGGGACAGCTGTGGTGGGTGG + Exonic
968074650 3:195809830-195809852 GTGTAAAAAGCAGTGGTGAACGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969175981 4:5399416-5399438 CTATGTACAGGAGTGGTGGATGG + Intronic
969328153 4:6455858-6455880 CTGTGGGCAGCAGTGGTTGGTGG - Intronic
969332343 4:6482760-6482782 TATTGAACAGCAGTGGTGGTAGG + Intronic
969591629 4:8125650-8125672 CTGTGGACAACTGTGCTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969898634 4:10328133-10328155 CTGTGACCATGAGGGGTGGAAGG - Intergenic
969957309 4:10904017-10904039 CTGGGAACAGAAGTGGTGGTAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971015305 4:22482982-22483004 CTGAGCACAGCAGTGGTAGCGGG + Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972281061 4:37602562-37602584 CTCTGATCAGCCGTGGGGGATGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975328985 4:73092139-73092161 GTGTTAGCAGCAGTGGTGGTAGG + Exonic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975644089 4:76529012-76529034 CTGTGAACATCAGCGGCAGATGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977992329 4:103459481-103459503 CTGTGAAGGGTAGTGGTGGTGGG + Intergenic
978356602 4:107881758-107881780 CTGGGAAGAGTAGTGGTGGGTGG - Intronic
978539864 4:109805051-109805073 CTGAGATCAGCAGAGGTGGGAGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978757804 4:112323130-112323152 CTCTGAGGAGCAGGGGTGGATGG - Intronic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982336875 4:154249880-154249902 CTGTGAACTGCTGAGGGGGAGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983845040 4:172507325-172507347 CTGTGACCAGCATTGGGGAAAGG + Intronic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985636394 5:1037895-1037917 CTGTGACCTGCGGTGGTGTACGG - Exonic
985834836 5:2262716-2262738 CTGTGCACAGCAGAGGTCAAAGG - Intergenic
986027429 5:3864135-3864157 CTGGGAACAGCATTTCTGGAAGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986513256 5:8531225-8531247 CTGTGGACAGCCAAGGTGGAAGG - Intergenic
987388697 5:17354730-17354752 CTCAGAGCAGGAGTGGTGGATGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990290848 5:54349895-54349917 CTGTGAACAACAGAAGTGAAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991172403 5:63643974-63643996 ATATGACCAGCAGTGGTGGTGGG - Intergenic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992099539 5:73393789-73393811 GTGTTAACAGCAGTGCTGCAGGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992643597 5:78791885-78791907 CTGTGCACAGCTGTTTTGGATGG + Intronic
993203450 5:84847975-84847997 CCCTGAACAACAGTGGTGAAGGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
993974348 5:94458403-94458425 CTGTGAAGAGCAATTGTGGGTGG + Intronic
994741644 5:103626332-103626354 CTGTGTTCAGCAGTGGATGAAGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997245416 5:132344412-132344434 CTGTGACCAGATGTGGTGGGGGG + Intergenic
998565812 5:143214967-143214989 CTGTGGACAGGAGAGGTGGCTGG - Intronic
999095170 5:148971463-148971485 CTGTTTACAGCAGTGATAGAGGG - Intronic
999366123 5:151024606-151024628 CTGTGAGCAGCAGCTGGGGAGGG + Intronic
999707220 5:154284541-154284563 CTCTGCACAGCAGCTGTGGATGG - Intronic
1002654854 5:180737832-180737854 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1002654861 5:180737897-180737919 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1002654868 5:180737962-180737984 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005689098 6:28284588-28284610 CCTTGAACTGCAATGGTGGAAGG + Intronic
1005962357 6:30703274-30703296 CTGTGAAGAGCACCTGTGGAAGG + Exonic
1008286799 6:49662890-49662912 CTGTCACCAGCAGTGGAGCAAGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010828984 6:80507905-80507927 GTGAGAAGAGCAGTGGTGTAAGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011237174 6:85230342-85230364 CTCAGAACAGGTGTGGTGGAGGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011887035 6:92109380-92109402 CTAGGAGCAGCAGAGGTGGATGG + Intergenic
1012288734 6:97424454-97424476 CACTGAAGAGCAGTGGTGAAGGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012949393 6:105502115-105502137 CTGTGAACAGCCCTGCTGTATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014546183 6:122739226-122739248 CTTTGAAAGGCAGAGGTGGATGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015992129 6:138956416-138956438 CTGTGAGCAGCAGTGGAGATGGG - Intronic
1016027271 6:139300097-139300119 TTGTGATCAGCAGGGGAGGAGGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017068189 6:150549330-150549352 CTGTGAACGGCAGTGCAGGCTGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1024019770 7:45357080-45357102 TATTGAATAGCAGTGGTGGAGGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024776892 7:52798229-52798251 CTGTGAACATCAGAGGTGGGTGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026905816 7:74062125-74062147 CTGTGAGCAGCGTTGGTGGGAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029196614 7:98810041-98810063 CTGTGGACAGCCGTGGGGTATGG - Intergenic
1029518289 7:101042202-101042224 CTGTCAACAGAAGGAGTGGAAGG - Exonic
1030092027 7:105866180-105866202 CTGTGAACATTAATGGTGTAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031382629 7:121106643-121106665 CTGTGAACAGGACAGGTGAAGGG - Intronic
1031512121 7:122663918-122663940 CTCTGAACACATGTGGTGGAAGG - Intronic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1032940348 7:136781324-136781346 CTGTGAACAGTAGTGGGTGGGGG + Intergenic
1033143952 7:138854955-138854977 CTGAGAAAAGCAGTGGTCAAGGG + Intronic
1033174826 7:139114240-139114262 CTTTGAGCAGCAGTGGGGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034292786 7:149945928-149945950 CTGGGAACAGGTGTGGAGGAGGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035050177 7:155994212-155994234 GTGTGTACAGCAGAGGAGGAGGG - Intergenic
1035876929 8:3200633-3200655 CTGTGTCAAGCAGTGGTGGGAGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037743257 8:21623829-21623851 CCTTGAACAGCAGCGCTGGATGG + Intergenic
1037773448 8:21817090-21817112 ACCTGAACAGCAGTGGAGGAGGG - Intergenic
1038181092 8:25228437-25228459 CAGTGTACAGCAGTGGCAGAGGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040642750 8:49358746-49358768 TTGTGAAAAGAAGTGGTGAAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044212412 8:89565117-89565139 CTTTGAAGAGCAGTGTTAGAAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045213592 8:100124517-100124539 CTGGGAACAGAAGAGGTGGCAGG + Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047105219 8:121724416-121724438 ATGTGAAGAGCAGAGCTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047771901 8:128036622-128036644 CTGTGAACTGCAGTGACGGGAGG - Intergenic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049674764 8:143884510-143884532 CTGTGAAGGGCACTGGTGGGAGG - Intergenic
1051064215 9:13082507-13082529 CTGTGAACAGGAGTGGCGACTGG + Intergenic
1051400795 9:16679874-16679896 CAGTGGATACCAGTGGTGGAAGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055105164 9:72504641-72504663 CTGTGAGCAGGAGTGGGGTAAGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057409773 9:94807879-94807901 GTGTGAACAGCTCTGCTGGAGGG + Intronic
1059722722 9:116976923-116976945 CTGTTAACCACAGTGGTTGATGG - Intronic
1059867319 9:118530062-118530084 CTGTGAAAAGCATAGGAGGAGGG + Intergenic
1060151187 9:121289362-121289384 CTGTGAGCACCAGTGTTGGCTGG + Intronic
1062367561 9:136218484-136218506 CTGGGAACAGCAGTGGACGCAGG + Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1187475867 X:19610298-19610320 TTATGAACAGGAGTGGTGGCAGG + Intronic
1187625051 X:21102002-21102024 CTGGGAAAAGCAGTGGGGGTGGG + Intergenic
1187978866 X:24733336-24733358 ATGTGAACAGCTGTTGTGTATGG + Intronic
1188051931 X:25498192-25498214 CTCTGAGTAGCAGTGGTGCAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190625294 X:52331441-52331463 CTCTGAAGGGCAGTGGTGAAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193634426 X:83930787-83930809 CTGTGAAAAGCAGAGGAGAAAGG - Intergenic
1193666503 X:84325756-84325778 CTGTGAACTGTAGTGGAGGTTGG + Intronic
1194424339 X:93718105-93718127 TTGTGAAAATCAGTGGTGAAAGG - Intergenic
1194824007 X:98539651-98539673 CTGGGAAGTGTAGTGGTGGAGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197641681 X:128974990-128975012 CCATGGACAGCAGTGGGGGAGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198502332 X:137263728-137263750 CTATAAACATCTGTGGTGGAAGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200043127 X:153384286-153384308 GTGTGGAGAGGAGTGGTGGATGG - Intergenic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201798480 Y:17927131-17927153 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1201803073 Y:17978826-17978848 CCGTGAAGAACAGTGGTGAAGGG - Intergenic
1202359800 Y:24095821-24095843 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1202510978 Y:25574293-25574315 CCGTGAAGAACAGTGGTGAAGGG - Intergenic