ID: 987739111

View in Genome Browser
Species Human (GRCh38)
Location 5:21882745-21882767
Sequence TCCCTTTGGCTCCATTGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 6, 2: 4, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987739111_987739114 5 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739114 5:21882773-21882795 AGTGATTATTGAGCAGAGCTGGG 0: 3
1: 2
2: 1
3: 19
4: 189
987739111_987739115 6 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739115 5:21882774-21882796 GTGATTATTGAGCAGAGCTGGGG 0: 3
1: 2
2: 2
3: 16
4: 172
987739111_987739113 4 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739113 5:21882772-21882794 CAGTGATTATTGAGCAGAGCTGG No data
987739111_987739116 30 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739116 5:21882798-21882820 AGTCCCAACGTAACAAAAGATGG 0: 1
1: 6
2: 3
3: 17
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987739111 Original CRISPR TCCCTTTGGCTCCATTGTAA CGG (reversed) Intronic
901468234 1:9437320-9437342 TCCCTCAGGCTCCTTTATAAAGG - Intergenic
902322681 1:15679656-15679678 TCCCCTTGGCTTCATTGCACTGG + Intergenic
904707797 1:32404587-32404609 TCCCTCTGGCTTCTGTGTAAGGG + Intergenic
904898723 1:33838675-33838697 TCCCTTTGGCATCATAGTAATGG - Intronic
910669658 1:89760609-89760631 TCCCTTGGGCTCCTTTATAAGGG - Intronic
915236870 1:154490010-154490032 TCACTTTTGCACCACTGTAAAGG + Intronic
917581414 1:176381917-176381939 CCCCATTGGCTTCAGTGTAAGGG + Intergenic
918740515 1:188124992-188125014 TCACTTTTGCTGCATTCTAATGG + Intergenic
919260088 1:195181213-195181235 GCCCTTTGGCTGTATTTTAATGG + Intergenic
923432663 1:233938293-233938315 TCCCTCTGTCTTCATTGTACTGG + Intronic
1063847406 10:10146008-10146030 TTCCTTTGGATCCATTGTATTGG - Intergenic
1065762859 10:28999329-28999351 TCGCTTTGGCTGCATTTTCAAGG - Intergenic
1071175139 10:82917353-82917375 TCCCTGTGACTTCATTGTGAAGG - Intronic
1072680472 10:97502442-97502464 TTCCTTTGGCACTAATGTAATGG + Intronic
1073125894 10:101148929-101148951 TCCTTTTTGCCCCATTGTATAGG + Intergenic
1074365386 10:112853692-112853714 TCACTTTTCCTCCATTGAAATGG - Intergenic
1079027929 11:16963495-16963517 TCCCTGGTGCTCCATTGTCAGGG - Intronic
1080831432 11:35896718-35896740 TCCCTCTGTCTACATTGTAGAGG + Intergenic
1082317217 11:50744732-50744754 TCCCTTTGTCGCAATTGTGAAGG + Intergenic
1087887841 11:103500697-103500719 TCTTTTTGGTTCCATTGTCATGG - Intergenic
1088802959 11:113323638-113323660 ACCCTTTGGATCTATTTTAATGG + Intronic
1088965613 11:114717978-114718000 TCCGTTTGATTCCATTTTAAGGG + Intergenic
1089520064 11:119057302-119057324 TCCCTTTGCCAGCCTTGTAATGG + Intergenic
1092118387 12:6025831-6025853 TCCCTCTGTCCCCATTGTCATGG - Intronic
1092299991 12:7238590-7238612 GCCATTTCTCTCCATTGTAAAGG + Intergenic
1092396216 12:8129039-8129061 TCCCTTTAGATCCATTATGATGG + Intronic
1092995042 12:13941636-13941658 TCCCTGTGGGTCCAGTTTAAGGG - Intronic
1093153302 12:15649600-15649622 TCCCTCTGGCTGTATTATAAGGG - Intronic
1093439222 12:19173658-19173680 TCCCTTTGGCTCCAGGGAACAGG + Intronic
1097091780 12:56511156-56511178 TCCCTTTGGCCCCATTGTAAGGG - Intergenic
1097488111 12:60231651-60231673 TTCCTTTAGCTCTATTGTCATGG - Intergenic
1099499770 12:83399562-83399584 TCCCTCTGGCATCATTCTAAAGG + Intergenic
1100027105 12:90143857-90143879 TCCCTTTGGAACAATTCTAAAGG - Intergenic
1101509251 12:105377947-105377969 TCCCATTGGCTCCATTTCTATGG - Intronic
1102443408 12:112981037-112981059 GCCCTTTGGCTGCTTTTTAATGG + Intronic
1103748255 12:123140882-123140904 TCCCTTTGGCCTCTTTGAAAAGG + Intronic
1104407018 12:128526398-128526420 TCCCTTAGTCTCTATTATAAGGG + Intronic
1104482041 12:129115917-129115939 TCCCTTTGTCCCCTTTGTGAGGG - Intronic
1104531002 12:129571114-129571136 TCCCTTTGGCTACATTCAAATGG - Intronic
1107222069 13:37994544-37994566 TCCCTTTGACCCCATTGTAATGG + Intergenic
1110641708 13:77831963-77831985 TCCCTTTTTCTTCATTTTAATGG + Intergenic
1110728082 13:78849354-78849376 TCCCTTTGGCCCTATTGTAATGG - Intergenic
1110958098 13:81582297-81582319 TCCCATTGTCTCTAATGTAAGGG - Intergenic
1111223058 13:85230495-85230517 TCCATTTGTCTTTATTGTAATGG + Intergenic
1113251691 13:108460311-108460333 TGCCTTTGGCTGCAATGTACTGG - Intergenic
1113526354 13:110980922-110980944 GCCCGTTGGATCCATTGGAAGGG + Intergenic
1114803223 14:25802974-25802996 TCCCTTAAGCTCTGTTGTAAGGG - Intergenic
1116290432 14:43029774-43029796 TCCCTGTAGCTAGATTGTAAAGG + Intergenic
1116426294 14:44795910-44795932 TCCCTTTGCCTCCCTAGTACAGG - Intergenic
1121695444 14:95908570-95908592 TACTGTTGGCTCCATTTTAAAGG + Intergenic
1124700170 15:31905561-31905583 TCCCTGAGGCTGCATTGTCAGGG - Intergenic
1125011441 15:34880374-34880396 TCACATTGCATCCATTGTAAAGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1137349767 16:47703340-47703362 CCCCTTTGCCCCCATTTTAATGG - Intergenic
1139932230 16:70537304-70537326 GCCCATTGTCTTCATTGTAACGG + Intronic
1140032688 16:71351033-71351055 TCCCTCTGGCTCCTGTGTAGGGG - Intergenic
1140283162 16:73574292-73574314 TGACTATGCCTCCATTGTAACGG + Intergenic
1140550562 16:75861352-75861374 TCCTTATGGCTCCATAGTATAGG - Intergenic
1142487971 17:259081-259103 TCCCTGTGAGTTCATTGTAACGG + Intronic
1143252369 17:5533039-5533061 CCCCTATGGCTGCACTGTAAGGG + Intronic
1145697508 17:26800723-26800745 TCCATTTGGTTCCATTCTATTGG - Intergenic
1146990323 17:37265142-37265164 TCACTTTGGCCACATTCTAATGG + Intronic
1147189778 17:38731613-38731635 TCTCTCTGGCTTCATTGCAAGGG - Intronic
1151459038 17:74243874-74243896 TGCCTTTGGATCCATTGCAAGGG + Intronic
1153721645 18:7909698-7909720 TCTCATTTGCTCCACTGTAAAGG + Intronic
1159179567 18:64884973-64884995 TCACTTTTGCACCAATGTAATGG + Intergenic
1159576315 18:70182471-70182493 TCCCTTTTGCTGCCTTGTCAGGG - Intronic
1164450846 19:28363093-28363115 TACCTTTGGCTACAGTGTGAGGG + Intergenic
1167755622 19:51411582-51411604 TCCCTTTCGCTGCCTTCTAAAGG - Intronic
926036758 2:9641854-9641876 TCCCCCTAGCTACATTGTAAAGG + Intergenic
926428205 2:12759179-12759201 TCCCTGGGAGTCCATTGTAAGGG + Intergenic
929131127 2:38573287-38573309 TCCCTCTGGTTCAGTTGTAATGG - Exonic
929629758 2:43447372-43447394 TCCCTCTGCCTCCTTTGTATAGG + Intronic
933449936 2:82435782-82435804 TCCCGGTTTCTCCATTGTAAGGG + Intergenic
935482907 2:103615674-103615696 TCCCCTTGACTCCATAGTCAAGG - Intergenic
935748340 2:106209220-106209242 CCCCTTTGGGTCCATTTTATGGG + Intergenic
937161932 2:119771899-119771921 TCACTCTGGCTACAGTGTAAAGG - Intronic
940930749 2:159427202-159427224 TCCCTTTAGCTGCATTGAAAGGG - Intronic
941233049 2:162935079-162935101 ACCTTTTGGAGCCATTGTAATGG - Intergenic
942448982 2:176097594-176097616 TCCCTCTGGCTCCGCTGTCAGGG + Intergenic
942701250 2:178713481-178713503 TCCATTTGGCTCTTTTGTGACGG + Intronic
944242258 2:197498672-197498694 TACCTTTGGCCCCATTGTAACGG + Exonic
944653094 2:201851500-201851522 TCCCTCTAGCTCCTTTATAAGGG + Intronic
945773380 2:214074075-214074097 TCCCTTGTGTTCCATTTTAAGGG - Intronic
947297691 2:228650744-228650766 TTCCTTTGCCTACTTTGTAATGG - Intergenic
948487907 2:238292439-238292461 TCCCAATGGCTCCTTTGCAAAGG + Intergenic
1170235058 20:14094064-14094086 TCCCTTTGGCTGCAGTGTGAAGG + Intronic
1171005644 20:21462931-21462953 TCCATTTCTCTCCATTGGAAAGG + Intergenic
1171920944 20:31098273-31098295 TCCATTTCACTCCATTGTATTGG - Intergenic
1171929448 20:31216433-31216455 TCCATTTCACTCCATTGTATTGG - Intergenic
1172192614 20:33071072-33071094 TCCCTTTGGGTCCATTTTACAGG + Intronic
1174189936 20:48733298-48733320 ACCCTTAGGCTCTATTGTATGGG + Intronic
1174319982 20:49734075-49734097 TCTCTTTGGCTCCTTTGGAGAGG - Intergenic
1175063272 20:56263378-56263400 TGCCTGTTGCTCCATTGCAATGG + Intergenic
1175672180 20:60913345-60913367 TCCCTTTGGCTTCTTTCTACTGG - Intergenic
1175701409 20:61140364-61140386 TCCATTTGCCTACATTTTAAGGG + Intergenic
1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1178263758 21:31123855-31123877 TCTCTATTGCTCCACTGTAATGG + Intronic
1178281275 21:31285059-31285081 TCCTCTTGGCTGCATGGTAAGGG - Intronic
1178622523 21:34189041-34189063 TGCCTCTGACTCCATTGTGATGG + Intergenic
1179402226 21:41094887-41094909 TGCTATTGGCTCCAGTGTAAAGG - Intergenic
1179995043 21:44970378-44970400 TCCCTTTGGCCCCATTGACGTGG + Intronic
1182531500 22:30962689-30962711 ACCCTTTGGCTACATTGTAAAGG - Intronic
1183830544 22:40416432-40416454 TGGCTTTGGCTCCATTGTGTGGG - Intronic
951837188 3:26996448-26996470 TTCCTTTGCCTCCATTTTCATGG + Intergenic
952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG + Intergenic
953041221 3:39256481-39256503 TCCATTTGGCTACTTCGTAAGGG - Intergenic
953282917 3:41575952-41575974 TCCCTTTGGCTCCACTGCCAGGG - Intronic
955154395 3:56402353-56402375 TCCCTTTGTTGCCATGGTAATGG + Intronic
956531074 3:70219603-70219625 TCCCTTTGGATCCATTCTGTTGG - Intergenic
956986106 3:74702445-74702467 TCCCTTAGGCTGCAGTGCAATGG - Intergenic
958595751 3:96219476-96219498 TCCATTTGGCTTCATTTTAGTGG - Intergenic
963680054 3:148362883-148362905 TCACTTTGGGTCCATTTTCATGG - Intergenic
964896209 3:161599397-161599419 TCGCTTTTTCTCCATTTTAAGGG + Intergenic
965042715 3:163531748-163531770 TCTTTTTAGCTCCTTTGTAATGG + Intergenic
967319916 3:188185005-188185027 TCCCATTGGCTTCATTTTTAGGG - Intronic
967425762 3:189325370-189325392 TCCATTTGGCTTCACTGAAAAGG - Intergenic
972024680 4:34362123-34362145 TGCCTTTGTCTCTGTTGTAATGG + Intergenic
975673236 4:76802376-76802398 TCCCTTTGGCTTCTTGGTGAGGG + Intergenic
975835457 4:78418209-78418231 TCCCTTTTTCTCCATTCTACTGG - Intronic
976839801 4:89418812-89418834 TCCCTTGGGCTCTTTTATAAGGG + Intergenic
977538458 4:98284652-98284674 TCCCTTCTGCTGCATTCTAATGG - Intronic
978961427 4:114684028-114684050 TCCATCTGGCTACATTTTAATGG + Intergenic
980586624 4:134825519-134825541 TTCCTTGGGCTCTTTTGTAAGGG - Intergenic
981446541 4:144845777-144845799 TCCCTTTGGCCCCATTGTAACGG - Intergenic
981451420 4:144902166-144902188 TCAGTTTGGTTACATTGTAATGG - Intergenic
982108038 4:152028453-152028475 ACCCTTTGGCTCCACTGGATTGG - Intergenic
987739111 5:21882745-21882767 TCCCTTTGGCTCCATTGTAACGG - Intronic
992588694 5:78270673-78270695 TCCCTTTGGCTACATAGCACTGG - Intronic
992595799 5:78346202-78346224 TCCCTTTGCCTACTTTGTGACGG - Intergenic
993849652 5:92990904-92990926 TCCCTTTGTCCCCATTGAGAGGG - Intergenic
994556461 5:101312608-101312630 TCCCTTTGTCTCCTCTATAAGGG + Intergenic
996361728 5:122655718-122655740 TCCCTTCCTCTCCATTGTAGAGG + Intergenic
996826693 5:127690720-127690742 TCCCTTGGGCGCCATTTTAGAGG - Intergenic
997676808 5:135719463-135719485 TCCCTTGGGCTCCATGGGGAGGG - Intergenic
997742259 5:136266816-136266838 TCACTTGGGCTTCATTCTAAGGG + Intronic
998604603 5:143621058-143621080 TCCCCTTGGCTCCCTTGACAGGG + Intergenic
1000578551 5:163007482-163007504 TTCCCTTGGCTTCATTGTGAGGG - Intergenic
1001633225 5:173192074-173192096 TCCCTCTGTGTCCCTTGTAAGGG + Intergenic
1007800142 6:44385349-44385371 TCCCTGTGGCCTCTTTGTAAGGG + Intergenic
1010355639 6:74929457-74929479 TCCCTTTGGGTCTATTTTCATGG - Intergenic
1010911196 6:81559125-81559147 TCCCTTTTTCTCCATTTTGATGG - Intronic
1012474714 6:99606414-99606436 TCCCCTTGGCTTTATTGTAAAGG - Intergenic
1014173536 6:118306351-118306373 ACCCCTTGATTCCATTGTAATGG + Intronic
1016549527 6:145262113-145262135 TCCATTTGTCTCCATTAGAAAGG - Intergenic
1016561300 6:145397694-145397716 TCCATTTAGCCCCATTGAAAAGG + Intergenic
1017449487 6:154541019-154541041 TCCCTCTGAATACATTGTAAAGG + Intergenic
1017670663 6:156766677-156766699 TCCCTTTGGCTGCAATGACAAGG - Intergenic
1021522577 7:21552247-21552269 TTCCTTTGGGACCATTGCAAGGG + Intronic
1022129601 7:27392592-27392614 AACCTTGGGCTCCATTGTAGTGG - Intergenic
1022861461 7:34371464-34371486 TCATTTTGGCTTCATTGGAAGGG + Intergenic
1030922662 7:115411477-115411499 TCCCATTAGCTCCATTAGAAAGG + Intergenic
1032991001 7:137395156-137395178 TCCCTTTGGCACCCATATAAGGG + Intronic
1034162581 7:149004111-149004133 GACCTTTGACTCCATTGTGATGG - Exonic
1034183400 7:149156046-149156068 TCCCTTTGGCTGCTTTGTGGAGG + Intronic
1035250440 7:157593649-157593671 GCCCTGGGGCTCCATTCTAAGGG + Intronic
1036283240 8:7418998-7419020 TCCCTTTGGCCCCATTGTAATGG - Intergenic
1036338231 8:7892523-7892545 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1038863800 8:31416363-31416385 TCCCTTTGGGCCCATTCTGAGGG + Intergenic
1039261919 8:35781142-35781164 TCCCTCTGGCTTCACTGCAAGGG - Intronic
1040526120 8:48226636-48226658 TTCCTCTGGCTCCATGGTTAAGG + Intergenic
1040663601 8:49604276-49604298 CCCCTGTGGCTACATTGTGAAGG - Intergenic
1043911225 8:85866641-85866663 TCCCTTTCACTGGATTGTAACGG + Intergenic
1044433426 8:92135167-92135189 TCCATTTTGCTCCATAATAAAGG - Intergenic
1046461181 8:114538389-114538411 TCACTTTTGCTCTTTTGTAATGG + Intergenic
1046991786 8:120466091-120466113 TCCCTTTTGCTGCATTGAACTGG - Intronic
1047843999 8:128786261-128786283 TCCCTTTGGCCCAAGTGAAAGGG - Intergenic
1048094813 8:131280239-131280261 CCCCTTTGGGTTTATTGTAAGGG - Intergenic
1049119108 8:140718423-140718445 TCGCTTTGGCTGCATTCTGAGGG - Intronic
1050538151 9:6647657-6647679 TCCCTTTGGCTCCGTGGTGATGG + Intergenic
1051352795 9:16214244-16214266 TCCCTTTGACTTCATAATAATGG + Intronic
1051658895 9:19408381-19408403 TCCCCTTGGCTCCAGCGTTAAGG - Intergenic
1052602514 9:30653601-30653623 TTCCTTTTTCTCCATTTTAAAGG + Intergenic
1055703741 9:78974966-78974988 TCCCTTCAGGTCAATTGTAATGG - Intergenic
1058335225 9:103819884-103819906 TTCCTTTGGGACCATGGTAAGGG - Intergenic
1058868479 9:109182870-109182892 ATCCTTTGGTTCCATTTTAAAGG - Intronic
1186035646 X:5420889-5420911 TCCATTTTGTACCATTGTAAAGG + Intergenic
1186348179 X:8716037-8716059 GCCCTTTGCCTCCATTTTGACGG - Intronic
1194110617 X:89829004-89829026 GTCCTTTGCCTACATTGTAATGG - Intergenic
1198375503 X:136034854-136034876 TACTTTTGGCTCCATTGTCAGGG + Intronic
1198716646 X:139564832-139564854 TCCCATTGGTGCCTTTGTAAGGG - Intergenic
1199799659 X:151236990-151237012 TCTCTATGGCTCCAATGGAAAGG - Intergenic
1201634990 Y:16112807-16112829 TCCATTTTGCACAATTGTAAAGG - Intergenic