ID: 987739111

View in Genome Browser
Species Human (GRCh38)
Location 5:21882745-21882767
Sequence TCCCTTTGGCTCCATTGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 6, 2: 4, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987739111_987739113 4 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739113 5:21882772-21882794 CAGTGATTATTGAGCAGAGCTGG No data
987739111_987739116 30 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739116 5:21882798-21882820 AGTCCCAACGTAACAAAAGATGG 0: 1
1: 6
2: 3
3: 17
4: 98
987739111_987739115 6 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739115 5:21882774-21882796 GTGATTATTGAGCAGAGCTGGGG 0: 3
1: 2
2: 2
3: 16
4: 172
987739111_987739114 5 Left 987739111 5:21882745-21882767 CCGTTACAATGGAGCCAAAGGGA 0: 1
1: 6
2: 4
3: 13
4: 159
Right 987739114 5:21882773-21882795 AGTGATTATTGAGCAGAGCTGGG 0: 3
1: 2
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987739111 Original CRISPR TCCCTTTGGCTCCATTGTAA CGG (reversed) Intronic