ID: 987739491

View in Genome Browser
Species Human (GRCh38)
Location 5:21887688-21887710
Sequence TCATATATGAAGGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987739491_987739495 -6 Left 987739491 5:21887688-21887710 CCCTCCAGGTCCTTCATATATGA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 987739495 5:21887705-21887727 ATATGATTAAAATTCCCTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987739491 Original CRISPR TCATATATGAAGGACCTGGA GGG (reversed) Intronic
900768343 1:4520453-4520475 TCATATATGGTGGAGGTGGAGGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906163340 1:43667601-43667623 TCATGTTTGAAGGTCCTGCAAGG + Intronic
906563835 1:46782189-46782211 TCATATATGAAGGACAGATATGG - Intronic
907288544 1:53397580-53397602 TCATACATGAAGGACTGGGGAGG - Intergenic
908609574 1:65842325-65842347 TCATATATGAAAGAGTTGCATGG + Intronic
908665026 1:66480906-66480928 TCATATAAGAACTACCGGGAGGG + Intergenic
909117613 1:71558503-71558525 ACATATATGAATGACATGGAAGG - Intronic
910347193 1:86253599-86253621 TCTTAAAGGAAGGAACTGGAGGG - Intergenic
910396124 1:86795595-86795617 TCATTTATGAGGGAACTGGCAGG - Intergenic
911947126 1:104126058-104126080 TCTTTCATGAAGGACCTGGTAGG + Intergenic
913247247 1:116880953-116880975 TCATTGCTGAAGGACTTGGAAGG + Intergenic
914691270 1:150030285-150030307 TTATAAATGTAGGGCCTGGAGGG - Intergenic
919335596 1:196228017-196228039 TAATATTTGAAGGACCTCAATGG - Intronic
1064731727 10:18338238-18338260 AAATGTATGAAGGACCTGAATGG + Intronic
1065332855 10:24621003-24621025 TTCTATGTGAAGGACCTGTATGG + Exonic
1067106649 10:43371117-43371139 TCCTAAAAGAGGGACCTGGAGGG - Intergenic
1067322756 10:45237681-45237703 TCATATATGAAGCACATATAAGG - Intergenic
1067961105 10:50851216-50851238 TCATCTATGAAGGAGTAGGAGGG + Intronic
1068406842 10:56600614-56600636 TCATTTATGGAACACCTGGAAGG + Intergenic
1072889515 10:99310120-99310142 TCTTATAAGAAGGAGCTGGTAGG - Intergenic
1073246057 10:102091003-102091025 TGATGTTTGAAGGAACTGGAAGG - Intergenic
1074179077 10:111041922-111041944 AGAAATATGAAGAACCTGGAAGG + Intergenic
1074251368 10:111753219-111753241 ACATATATGCAGGACCTGTTAGG - Intergenic
1074973125 10:118558256-118558278 ACAGATGTGAAGGCCCTGGAGGG - Intergenic
1075546100 10:123356000-123356022 TCATCTCTGAGGGTCCTGGAAGG + Intergenic
1075814946 10:125257758-125257780 TCACATAGGAAGGCCCAGGAGGG + Intergenic
1079372446 11:19863128-19863150 TCAGATAGGAAGGACTTGGCTGG + Intronic
1080000394 11:27341870-27341892 TCATCTTTGAGGGACCTGGTGGG + Intronic
1082762732 11:57143154-57143176 TCACATATGAAAGACTTCGAAGG + Intergenic
1086802341 11:91192761-91192783 TCATATTTGGGGGACCTGGCAGG - Intergenic
1087510550 11:99086959-99086981 TCATAGATGAAGAAAATGGAGGG + Intronic
1089636003 11:119812149-119812171 ACATATATGAAGTACCTACAAGG + Intergenic
1089754628 11:120677621-120677643 TCAGACATGAAGGAACTAGAGGG + Intronic
1092066501 12:5594260-5594282 ACATTTATTAAGCACCTGGAGGG - Intronic
1094246687 12:28304912-28304934 TCAAATATAAAGGTCCTGAAAGG - Intronic
1095177501 12:39110250-39110272 TCAGATGTGAAGGGCCTTGAGGG - Intergenic
1096957013 12:55536255-55536277 TCATATATGAAGGAAATATATGG + Intergenic
1097831630 12:64230632-64230654 TCATATATAAAGCACTTGGCCGG - Intergenic
1101318192 12:103649155-103649177 TCATACCTGAAGGATCTAGAAGG - Intronic
1101403041 12:104404815-104404837 TCATAAAGGAAGCTCCTGGAGGG + Intergenic
1107443736 13:40451189-40451211 TCATTCTTGAATGACCTGGAAGG + Intergenic
1107794940 13:44041629-44041651 TTACATATGGTGGACCTGGAAGG + Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1109594529 13:64532832-64532854 TCAGATATGAAGGATGTGGGGGG - Intergenic
1110144755 13:72177182-72177204 TCCTATAAGAAAGACCTGGGGGG + Intergenic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1114496867 14:23138915-23138937 ACATCTAAGAAGGACCTGGGAGG - Intronic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1117367528 14:55044265-55044287 TCATAGAAGAAGGAATTGGAAGG - Exonic
1120518406 14:85497425-85497447 TCATATGTGAATGACAAGGAAGG - Intergenic
1122499856 14:102190152-102190174 ACATTGATGAGGGACCTGGAAGG - Intronic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1128914777 15:71549850-71549872 TCAGATAAGCAGGACCTGGCAGG + Intronic
1129376391 15:75135925-75135947 TCATTTATGAATGACCTTGATGG - Intergenic
1130064402 15:80592410-80592432 TCCTGTTAGAAGGACCTGGAGGG - Intronic
1130333601 15:82940352-82940374 CTATATATGAAAGACCTGCAAGG + Intronic
1133081695 16:3326414-3326436 TCAGAGATCAGGGACCTGGATGG - Intergenic
1136015322 16:27395713-27395735 CCATATATGAAAAACCTGGCTGG + Intergenic
1139565765 16:67775013-67775035 TCATATATGAAAAACCTGGCTGG + Intronic
1141341472 16:83207947-83207969 TAAAAGATGAAGGATCTGGATGG + Intronic
1142798134 17:2325254-2325276 TCATCTATTAAGGACCTGCAGGG + Exonic
1146089768 17:29864927-29864949 TTATATCTGAATTACCTGGAGGG - Intronic
1146677125 17:34781361-34781383 TCAGAGAGGAAGGGCCTGGATGG + Intergenic
1147303744 17:39549403-39549425 TCATAGGTAAAGGACCTGAAAGG - Intronic
1149091503 17:52788648-52788670 TCATATGTGAAGGAAATGGTAGG - Intergenic
1152162763 17:78679303-78679325 TCATGGATGAAGCACCAGGAGGG + Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1159524555 18:69570629-69570651 TCTTTTATGAAAGACCTGGTAGG - Intronic
1160088751 18:75806030-75806052 CCAGATTTGAAGTACCTGGAAGG - Intergenic
1163866579 19:19778017-19778039 TGATATGAGAGGGACCTGGAGGG + Intergenic
1163894953 19:20050792-20050814 TGATATGAGAGGGACCTGGAGGG - Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927464974 2:23329931-23329953 TTATAGATGAAGGAGCTGCAGGG - Intergenic
929832781 2:45361198-45361220 TCATATATAAAGGACCCAGATGG - Intergenic
930376473 2:50573413-50573435 TCTCAGATGAAGGACCTGGATGG + Intronic
931148515 2:59546222-59546244 TTATAGATGAATAACCTGGAGGG + Intergenic
932373404 2:71212405-71212427 TTATTTATTAAGGACCTGGTGGG - Intronic
934879868 2:97966899-97966921 TCTTATATGAGGGACCTGCCTGG - Intronic
936523736 2:113228804-113228826 TGAGGTATGAAGGACCTGGGGGG - Intronic
938311470 2:130291734-130291756 TTATCTATGAAAGATCTGGATGG + Intergenic
938917879 2:135962073-135962095 TAAAATATGAAGGACTAGGAAGG - Intronic
939866332 2:147476631-147476653 ACACATATGAATGTCCTGGATGG - Intergenic
943366639 2:186972935-186972957 TCACAGAGGAAGGACCGGGAGGG + Intergenic
943597438 2:189875358-189875380 TCATATATGTGGGTTCTGGAGGG - Intronic
945656700 2:212632759-212632781 TCACATAAGAATCACCTGGAGGG - Intergenic
946618083 2:221530910-221530932 TAATATTTGAAGGACCTCCAGGG - Intronic
947183230 2:227431417-227431439 TAATATTTGAAGGACCAGGGGGG - Intergenic
947430181 2:230021153-230021175 TCAGATGTGAAGGCCGTGGAAGG - Intergenic
948376519 2:237524696-237524718 TCATAGATGCTGTACCTGGAAGG + Intronic
1178130823 21:29570980-29571002 CCATATATGAATGACCCTGAAGG + Intronic
1181372574 22:22429938-22429960 TGATAAAAGGAGGACCTGGAAGG + Intergenic
1181766997 22:25099315-25099337 TCACATAGCAAGGAGCTGGAGGG + Intronic
1181895089 22:26100040-26100062 TCTTACCTGGAGGACCTGGATGG + Intergenic
949404445 3:3699593-3699615 TCAGATATGGAGGCCCTGAATGG + Intergenic
949454125 3:4220405-4220427 TCACACATGAAAAACCTGGAGGG - Intronic
954239007 3:49278654-49278676 TCATTTATGAAGGTCCCTGAAGG + Intronic
954898116 3:53994842-53994864 TCAGCTCTGAAGGACTTGGAGGG - Intergenic
956374220 3:68596906-68596928 CCCTATAGGAAAGACCTGGAAGG + Intergenic
957518711 3:81290871-81290893 TCACATATGAAGGTTCTGCAGGG - Intergenic
958693407 3:97497435-97497457 TAGTTTATGAAGGACCTGAAAGG - Intronic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
962372790 3:134834620-134834642 TCATCTAAGAAGTAGCTGGAGGG - Intronic
962754359 3:138456876-138456898 CCATATCAGAAGAACCTGGAGGG + Intronic
970061845 4:12042336-12042358 TCATATATGAGGGATGTGGAAGG - Intergenic
972862575 4:43188840-43188862 TCATTGATCAAGGACCTGGTTGG + Intergenic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973979751 4:56298206-56298228 GAATAGTTGAAGGACCTGGAAGG - Exonic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
977463346 4:97354101-97354123 TCATTCATGAGGGGCCTGGATGG + Intronic
977862354 4:101978416-101978438 ATATATATGATGTACCTGGAAGG + Intronic
978468331 4:109033021-109033043 TCCTTTATGGAGGACCTGGTGGG - Intronic
978872351 4:113594493-113594515 TCATATATGAAGGGCTTTAATGG + Intronic
981878000 4:149572082-149572104 TGATATATGATGACCCTGGATGG + Intergenic
982531122 4:156545328-156545350 TCTTATATGAATGACCTGGTTGG + Intergenic
985829329 5:2216549-2216571 TCACATGGGAAGCACCTGGATGG - Intergenic
986920688 5:12675852-12675874 TCATATATCACTGACCTGAATGG + Intergenic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987739491 5:21887688-21887710 TCATATATGAAGGACCTGGAGGG - Intronic
989695009 5:44190065-44190087 TCATATATGATTGTCATGGAAGG - Intergenic
990517413 5:56543077-56543099 TCATATAAGCAGAACCTGGGAGG - Intronic
991353540 5:65745067-65745089 TCAAACATGGAAGACCTGGATGG - Intronic
992613262 5:78525955-78525977 TCAGATAGGAAGAAGCTGGAAGG - Intronic
999150929 5:149425397-149425419 TCCTACATGGAGGACCAGGAAGG - Intergenic
999773311 5:154791716-154791738 TCATATATGTAGGTCCTGCAGGG - Intronic
1000204692 5:159047708-159047730 TGATGTGTGAAGGACCTTGAAGG - Intronic
1001200239 5:169709336-169709358 CCATATGAGAAGGACCTGGAGGG - Intronic
1001237561 5:170042970-170042992 TCATAAATGAATGAACTGAATGG + Intronic
1006912580 6:37572934-37572956 TCATATAAGAAGTACCTGGCAGG - Intergenic
1009669277 6:66725943-66725965 TGATAGATGAAGGATATGGATGG + Intergenic
1010791392 6:80069265-80069287 TTCTATGTGAAGGACCTGTATGG + Intergenic
1011479614 6:87781000-87781022 TATTATATGAAGGACATGTAAGG + Intergenic
1012395461 6:98791198-98791220 ACATATAAGAAGGGCCTGAATGG - Intergenic
1012448176 6:99327948-99327970 TCATTTCTGAAGGGCCTTGAGGG - Intronic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1014084187 6:117323767-117323789 TCATTTATAAATGACCAGGAAGG - Intronic
1016625444 6:146161842-146161864 TCATATCTGAATGTCATGGAAGG - Intronic
1020146842 7:5650939-5650961 TTAAATATGAAGGATATGGAAGG - Intronic
1021005296 7:15387451-15387473 TCATATTTAAGGGACCGGGATGG - Exonic
1027724045 7:81780761-81780783 TCATATATGATGGACCTACCTGG - Intergenic
1027920010 7:84381069-84381091 TCCTATATGTAGGATCTGGTAGG - Intronic
1028487077 7:91371777-91371799 TTATAGATGAAGGGACTGGAAGG - Intergenic
1034879583 7:154753038-154753060 TCATGCCTGAAGGACCTGGGAGG + Intronic
1037459611 8:19095709-19095731 TGCTATAAAAAGGACCTGGAAGG - Intergenic
1038054069 8:23841575-23841597 GCATAAATAAAAGACCTGGAAGG + Intergenic
1042717566 8:71790960-71790982 TCATAGATGAAGAACCTAAAGGG - Intergenic
1044204378 8:89475061-89475083 TAATATATGAAGGCCCTGAGCGG - Intergenic
1044520320 8:93191822-93191844 TAATATATGAAGGACCGTTATGG - Intergenic
1045975227 8:108123624-108123646 TCTTGTATGTAGCACCTGGATGG - Intergenic
1048829953 8:138466159-138466181 TCATATGCAGAGGACCTGGAAGG + Intronic
1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG + Intergenic
1055114496 9:72592301-72592323 ACATATATGTGGAACCTGGAAGG + Intronic
1057879528 9:98782671-98782693 GCATTTAAGAAGGACATGGAAGG + Intronic
1058154834 9:101503616-101503638 TCTTTTATGAAAGACCTTGATGG - Intronic
1058477078 9:105347138-105347160 CCATATGAGAAGGAACTGGAAGG - Intronic
1058566748 9:106293892-106293914 TCTTTTATGACGGACCTTGAAGG - Intergenic
1058737610 9:107908414-107908436 TCTTATCTGAAGGCCCTGGGAGG + Intergenic
1061117584 9:128624355-128624377 TCAAAGATGAAGGGCCTGAACGG + Exonic
1061175527 9:128993875-128993897 TTAAATATTAAGCACCTGGAAGG + Intronic
1187110832 X:16298105-16298127 TTATATATGAAAGTCCTTGATGG + Intergenic
1187615586 X:20990401-20990423 TTTTATATAAAGCACCTGGATGG + Intergenic
1192275757 X:69629278-69629300 TGAGCTTTGAAGGACCTGGAGGG - Intronic
1193263649 X:79441324-79441346 TTGTACATGAAGGACCTGTATGG + Intergenic
1196568900 X:117242689-117242711 TAACATTTCAAGGACCTGGAAGG - Intergenic
1200750067 Y:6936775-6936797 TCATAAGTGAAGAACCTGAAAGG - Intronic