ID: 987744148

View in Genome Browser
Species Human (GRCh38)
Location 5:21948334-21948356
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1366
Summary {0: 2, 1: 6, 2: 60, 3: 250, 4: 1048}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987744148_987744153 -7 Left 987744148 5:21948334-21948356 CCACCCCTTGCATTAACATGCCC 0: 2
1: 6
2: 60
3: 250
4: 1048
Right 987744153 5:21948350-21948372 CATGCCCTGGATGTGAAACATGG 0: 11
1: 108
2: 735
3: 1215
4: 1840
987744148_987744156 1 Left 987744148 5:21948334-21948356 CCACCCCTTGCATTAACATGCCC 0: 2
1: 6
2: 60
3: 250
4: 1048
Right 987744156 5:21948358-21948380 GGATGTGAAACATGGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987744148 Original CRISPR GGGCATGTTAATGCAAGGGG TGG (reversed) Intronic
900237171 1:1598385-1598407 GGGCATGCAAAGGCTAGGGGTGG + Exonic
900852353 1:5153975-5153997 GGGCATGCTGATGTAAGAGGTGG - Intergenic
900939712 1:5790701-5790723 GGTCATGCTGATGCAAGAGGTGG - Intergenic
902540768 1:17152848-17152870 GGGCATCCTGATGCAGGGGGTGG - Intergenic
905352538 1:37357467-37357489 GGGCATGTTCAGGCAAGGGCTGG - Intergenic
906369541 1:45241110-45241132 GGTCATGTTGATGCAAGAGGTGG + Intronic
906655188 1:47543065-47543087 GGTCATGCTGATGCAAGAGGTGG - Intergenic
906835859 1:49083032-49083054 GGTCATGCTGATGCAAGAGGTGG + Intronic
906937373 1:50226009-50226031 GGGCATGCAGATGCAAGGGGTGG - Intergenic
907315485 1:53568162-53568184 GGGCATGCTGATGTAAAGGGTGG - Intronic
907925728 1:58953641-58953663 GGTCATGCTGATGCAAGAGGTGG - Intergenic
908011819 1:59786149-59786171 GGTCATGCTGATGCAAGAGGTGG + Intergenic
908019942 1:59889089-59889111 GGTCATACTAATGCAAGAGGTGG + Intergenic
908171477 1:61509394-61509416 GGGCCTGTCAGTGCAGGGGGAGG + Intergenic
908407682 1:63831034-63831056 GGGCATGCTGATGCAAGAGGTGG + Intronic
908620713 1:65976178-65976200 GGGCATGCTGATTCAAGGGGTGG - Intronic
908746773 1:67383883-67383905 GGTCATGCTGATGCAAGAGGTGG + Intronic
908871661 1:68620199-68620221 GGTCATGCTGATGCAAGAGGTGG + Intergenic
908879097 1:68710506-68710528 GGGCACATTGATGCAAGAGGTGG - Intergenic
908932223 1:69331219-69331241 GGGCATGCTCATCCAAGGGATGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909096171 1:71291295-71291317 GGTCATGCTGATGCAAGAGGTGG - Intergenic
909105251 1:71398391-71398413 GGTCATGCTGATGCAAGAGGTGG - Exonic
909245018 1:73270164-73270186 GGTCATGCTGATGCAAGAGGTGG - Intergenic
909250300 1:73344647-73344669 GGTCATGCTGATGCAAGAGGTGG - Intergenic
909405337 1:75282153-75282175 GGTCACGCTAATGCAAGAGGTGG - Intronic
909416933 1:75416717-75416739 GGTCATGCTGATGCAAGAGGTGG - Intronic
909436434 1:75647638-75647660 GGTCATGCTGATGCAAGAGGTGG - Intergenic
909632865 1:77785702-77785724 GGTCATGCTGATGCAAGAGGTGG + Intronic
909773579 1:79457121-79457143 GGGCACACTGATGCAAGGGGTGG - Intergenic
909833981 1:80230826-80230848 GGCCATGCTGATGCAAGGGCTGG + Intergenic
910064916 1:83141359-83141381 GGTCATGCTGATGCAAGAGGTGG - Intergenic
910256062 1:85248684-85248706 GGTCATGCTAATGCAAGAGGTGG + Intergenic
910357505 1:86377245-86377267 GGTCATGCTGATGCAAGGAGTGG + Intronic
910628970 1:89337507-89337529 GGTCATGCTGATGCAAGAGGTGG - Intergenic
910721985 1:90296451-90296473 GGGCATGTTGATGCAAGCTTGGG - Intergenic
911158755 1:94661522-94661544 GGGTATGGTAATCCAAGGGAGGG + Intergenic
911242165 1:95478657-95478679 GGTCATGCTGATGCAAGAGGTGG - Intergenic
911309548 1:96276026-96276048 GGTCATGCTGATGCAAGAGGTGG - Intergenic
911407912 1:97465041-97465063 GGTCATGCTGATGCAAGAGGTGG - Intronic
911695815 1:100889772-100889794 GAACATGTTGATGCAAGAGGTGG + Intronic
911829853 1:102536872-102536894 GGGAATGCTGATGCAAAGGGTGG + Intergenic
911893472 1:103401418-103401440 GGTCATGCTGATGCAAGAGGTGG + Intergenic
911972200 1:104452705-104452727 GGGCACAATGATGCAAGGGGTGG - Intergenic
911985418 1:104616464-104616486 GGGCATGCTTATGCAAGAGGTGG + Intergenic
912052004 1:105541555-105541577 GGGCAGGCTGATGCAAGAGGTGG + Intergenic
912070248 1:105800666-105800688 GGACATGCTGATGCAAGGAGTGG + Intergenic
912263515 1:108132030-108132052 GGTCATGCTGATGCAAGAGGTGG + Intergenic
912327755 1:108784937-108784959 GGTCATGTTGATGCAAAAGGTGG + Intronic
912735998 1:112149916-112149938 GGGCATGCTGAGGCAAGGGGTGG - Intergenic
913101786 1:115574095-115574117 GGCCATGCTGATGCAAGTGGTGG - Intergenic
913254139 1:116938992-116939014 GGTCACGCTAATGCAAGAGGTGG + Intronic
913278004 1:117157994-117158016 GGTCATGCTGATGCAAGAGGTGG + Intronic
913316539 1:117558580-117558602 GGTCATGCTGATGCAAGAGGTGG + Intergenic
913396542 1:118377938-118377960 GGGCATGCTGATGCAAGGAGTGG - Intergenic
915787027 1:158624398-158624420 GGGCACACTGATGCAAGGGGTGG - Intronic
916477454 1:165183681-165183703 GGTCATGCTGATGCAAGAGGTGG - Intergenic
916734744 1:167597858-167597880 GGTCATGCTGATGCAAGAGGTGG + Intergenic
916790382 1:168120212-168120234 GGGCATGCTGATGCAAGGGGTGG - Intronic
916829310 1:168474793-168474815 GAGCATGCTGATGCAAAGGGTGG - Intergenic
917022168 1:170601510-170601532 GGTCATGCTGATGCAAGAGGTGG + Intergenic
917035391 1:170742723-170742745 GGGCATGCTGCTGCAAGAGGTGG + Intergenic
917290909 1:173471363-173471385 GGTCATGCTGATGCAAGAGGTGG - Intergenic
918844829 1:189595347-189595369 GGGCATGCTGATGCAAGAGGTGG - Intergenic
918931370 1:190860180-190860202 GGTCATGCTGATGCAAGAGGTGG + Intergenic
919221861 1:194639955-194639977 GGTCATGCTGATGCAAGAGGTGG - Intergenic
919536676 1:198796632-198796654 GGCCATGCTGATGGAAGGGGTGG + Intergenic
920594466 1:207255254-207255276 GGTCATGCTGATGCAAGAGGTGG + Intergenic
920734237 1:208516518-208516540 GGTCATGCTGATGCAAGAGGCGG + Intergenic
920800576 1:209183650-209183672 GGGCATGCTGATACAAGGGGTGG - Intergenic
920895864 1:210049012-210049034 GGTCATGCTGATGCAAGGGGTGG + Intronic
921758281 1:218883612-218883634 GGGCACACTGATGCAAGGGGTGG + Intergenic
921816874 1:219574294-219574316 TGGCATGATGCTGCAAGGGGTGG + Intergenic
922666190 1:227471431-227471453 GGCCATATTGATGCAAGGGGTGG - Intergenic
922709073 1:227813628-227813650 GGTCATGCTGATGCAAGAGGTGG + Intergenic
922900845 1:229135288-229135310 GGTCATGCTGATGCAAGAGGTGG - Intergenic
923297900 1:232612489-232612511 GGTCATGCTGATGCAAGAGGTGG - Intergenic
923997044 1:239506838-239506860 GGTCATGCTGATGCAAGAGGTGG - Intronic
924036506 1:239943689-239943711 GGTCATGCTGATGCAAGAGGTGG + Intergenic
924050887 1:240078591-240078613 GGTCATGCTGATGCAAGAGGTGG - Intronic
1062770426 10:96084-96106 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1063481437 10:6380139-6380161 GGTCATGTTGATGCAAAAGGTGG + Intergenic
1064902632 10:20311662-20311684 GGCCATGCTGATGCCAGGGGTGG + Intergenic
1065087657 10:22196012-22196034 AAGCATGTTAATTCTAGGGGAGG + Intergenic
1065405412 10:25357992-25358014 GGTCATGTTGATGCAAGAGCTGG - Intronic
1066098745 10:32098211-32098233 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1067351603 10:45481035-45481057 GGTCATGCTAATGCAAGAGGTGG - Intronic
1067828058 10:49593709-49593731 GGGTGTGATGATGCAAGGGGTGG - Intergenic
1068416752 10:56733692-56733714 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1068452598 10:57211698-57211720 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1068494992 10:57776305-57776327 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1068604551 10:58990620-58990642 GGGCATGCTGATCCAAGAGGTGG - Intergenic
1068667141 10:59688964-59688986 GGGCATGGCAATGCAAGGGAGGG - Intronic
1068875017 10:61986613-61986635 GGACATTTTAATGCACAGGGGGG - Intronic
1069040869 10:63694235-63694257 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1069175681 10:65286053-65286075 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1069239585 10:66123348-66123370 GGTCATGCTGATGCAAGAGGTGG + Intronic
1069577501 10:69541288-69541310 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1070816160 10:79324882-79324904 GGCCATGTTACTCCAAGGAGAGG + Intergenic
1071395462 10:85219035-85219057 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1071873385 10:89818666-89818688 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1072741614 10:97913369-97913391 CAGAATGTTAAGGCAAGGGGTGG + Intronic
1073461159 10:103666770-103666792 GGTCATTTTAAAGCAAGTGGAGG + Intronic
1073734148 10:106326746-106326768 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1073752256 10:106542127-106542149 GGGAATGTTAATTCAAGGACAGG + Intergenic
1073880486 10:107974733-107974755 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1073964955 10:108978300-108978322 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1073994062 10:109295399-109295421 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1074069206 10:110049524-110049546 GGTCACGCTGATGCAAGGGGTGG - Intronic
1074619675 10:115106133-115106155 GGTCATGCTGATGCAAGAGGTGG - Intronic
1075543601 10:123336953-123336975 GGTGATGTTGATGCAAGAGGTGG + Intergenic
1076435155 10:130435671-130435693 GGGCATGTTAATAATAGGAGAGG - Intergenic
1077426152 11:2479052-2479074 GGTCATGCTGATGCAAGAGGTGG + Intronic
1077740775 11:4843039-4843061 GGGCATGCTGATGCAAGGCGTGG + Intronic
1077979494 11:7285892-7285914 GGTCATGCTGATGCAAGAGGTGG + Intronic
1078515030 11:12014600-12014622 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1078686676 11:13538515-13538537 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1079511552 11:21216556-21216578 GGGCATGCTGATGCAAGAGGTGG - Intronic
1079521222 11:21328734-21328756 GGTCATGCTGATGCAAGAGGTGG - Intronic
1079556133 11:21760662-21760684 GGGCATGCTGTTGCAAGAGGTGG + Intergenic
1079656043 11:22987846-22987868 GGTCATGCTGATGCAAGAGGCGG + Intergenic
1079673585 11:23198647-23198669 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1079721184 11:23816663-23816685 GGTCATGTTGATGCAAGTGGTGG + Intergenic
1079838441 11:25364982-25365004 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1080192707 11:29570742-29570764 GGGCATACTGATGCAAGGGGTGG + Intergenic
1080395223 11:31883662-31883684 GGGCATGTTGATGATGGGGGAGG + Intronic
1080477389 11:32608438-32608460 GGTCACGCTAATGCAAGAGGTGG + Intronic
1080817499 11:35772521-35772543 GGTCATGCTGATGCAAGAGGTGG - Intronic
1080909447 11:36581147-36581169 AGGCATGTTTCTGCAAGCGGTGG + Intronic
1080982334 11:37423639-37423661 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1081045551 11:38269459-38269481 GGGCACACTGATGCAAGGGGTGG + Intergenic
1081167039 11:39819804-39819826 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1081249631 11:40813909-40813931 GGGCATGTTGATGCAAGAGGTGG + Intronic
1081309596 11:41553958-41553980 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1081315509 11:41625179-41625201 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1081349057 11:42026621-42026643 GGGCATGCTGATGCAAGAAGTGG + Intergenic
1081354477 11:42095619-42095641 GGTCATGTTGGTGCAAGAGGTGG - Intergenic
1081358556 11:42144331-42144353 CGGCATGCTGATGCAAGGGGTGG + Intergenic
1081886875 11:46505653-46505675 GGTCATGCTAAAGCCAGGGGAGG + Intronic
1082270760 11:50167041-50167063 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1082287719 11:50335191-50335213 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1082692663 11:56324930-56324952 GGGAATGCTGATGTAAGGGGTGG - Intergenic
1082734217 11:56838547-56838569 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1082827065 11:57587609-57587631 GGGCATGCTGGTGCAAGGGGTGG - Intergenic
1083500696 11:63105117-63105139 GGTCATGCCGATGCAAGGGGTGG + Intronic
1083650957 11:64204431-64204453 GGGCATGTTATGGGGAGGGGAGG + Exonic
1085086524 11:73671562-73671584 GGGCACATTGATGCAAGGGTTGG + Intergenic
1085418455 11:76335490-76335512 GGCCACATTGATGCAAGGGGTGG - Intergenic
1085588277 11:77732127-77732149 GGTCATGCTGATGCAAGTGGTGG - Intronic
1085866814 11:80304038-80304060 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1086176826 11:83900970-83900992 GGTCATGCTGATGCAAGAGGTGG - Intronic
1086314531 11:85577032-85577054 GGGCATGTTAGTAGAAGAGGTGG + Intronic
1086519173 11:87650667-87650689 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1086601714 11:88641750-88641772 GGGCATGTGGGTGCAAGGGGTGG + Intronic
1086669785 11:89532332-89532354 GGGCATGCTGCTGCAAGGGGTGG - Intergenic
1086933762 11:92722360-92722382 GGTCATGCTGATACAAGGGGTGG + Intronic
1086991911 11:93313155-93313177 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1087255169 11:95945252-95945274 GGTCATGCTGATGCAAGGAGTGG - Intergenic
1087336655 11:96852234-96852256 GGACATGCTGATGCAAGGAGTGG - Intergenic
1087438368 11:98151489-98151511 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1087474260 11:98617677-98617699 GGGCACACTGATGCAAGGGGTGG + Intergenic
1087493781 11:98863689-98863711 GGTAATGTTGATGCAAGAGGTGG + Intergenic
1087574624 11:99975226-99975248 GAGCATGCTGCTGCAAGGGGTGG - Intronic
1087574758 11:99976170-99976192 GGGAGTGCTGATGCAAGGGGTGG + Intronic
1087731175 11:101779913-101779935 GGCCATGCTAATGCAAGAGGTGG - Intronic
1087831666 11:102825853-102825875 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1088388757 11:109290402-109290424 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1088397241 11:109382221-109382243 GGGCACGATGATGCAAGGGGTGG + Intergenic
1088426895 11:109714406-109714428 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1088953790 11:114598231-114598253 GGGCACACTAACGCAAGGGGTGG + Intergenic
1089746243 11:120619137-120619159 GGGCATACTAGTGCAAGGGGTGG - Intronic
1090431396 11:126649609-126649631 GGTCATGCTGATGCAAGAGGTGG + Intronic
1090556814 11:127885230-127885252 GGTCATGCTAAAGCAAGAGGTGG + Intergenic
1090595300 11:128314771-128314793 GGGTATGCTGATGCAAGAGGTGG + Intergenic
1090727319 11:129539664-129539686 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1090756289 11:129794717-129794739 GGGCACACTAATGCAAGGGGTGG + Intergenic
1091065755 11:132510057-132510079 GGTCATGCTGATGCAAGAGGTGG - Intronic
1091350780 11:134892336-134892358 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1091811802 12:3405728-3405750 GGTCATGCTGATGCAAGAGGTGG + Intronic
1092326340 12:7535020-7535042 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1092485749 12:8900897-8900919 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1092944244 12:13438534-13438556 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1093037991 12:14351433-14351455 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1093076225 12:14761270-14761292 GGTCATGTTGATGCAAAGGTGGG - Intergenic
1093141779 12:15517769-15517791 GGTCATGCTGATGCAAGAGGTGG + Intronic
1093207126 12:16264207-16264229 GGTCATGCTAATGCAAGAGGTGG - Intronic
1093238500 12:16640690-16640712 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1093350949 12:18102885-18102907 GGGCATGCTGATGCAAGAGGTGG + Intronic
1093426264 12:19032452-19032474 GGGCATATTGATGCAAGAGATGG + Intergenic
1093478824 12:19583825-19583847 GGGCATGCTGATGCAAGGGGTGG - Intronic
1093537351 12:20237820-20237842 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1093974004 12:25401153-25401175 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1094420320 12:30264077-30264099 GGTCATGCTGATGTAAGGGGTGG - Intergenic
1094421100 12:30272410-30272432 TGGCATGCTGATGCAAGAGGTGG + Intergenic
1094489189 12:30948111-30948133 GGTCATGTTGATGTAAGAGGTGG + Intronic
1094716250 12:33017769-33017791 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1095111169 12:38296228-38296250 GGTCATGATGATGCAAGAGGTGG + Intergenic
1095235081 12:39785753-39785775 GGTCATGCTGATGCAAGAGGTGG - Intronic
1095382881 12:41615945-41615967 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1095731484 12:45511213-45511235 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1096935508 12:55269206-55269228 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1097142033 12:56909845-56909867 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1097302695 12:58035463-58035485 GGGCACACTGATGCAAGGGGTGG + Intergenic
1097411074 12:59253474-59253496 GGGCATGCTGGTACAAGGGGTGG - Intergenic
1097445700 12:59668373-59668395 GGACATGCTGATGCAAGAGGGGG - Intronic
1097492743 12:60291004-60291026 GGGCATGCTGATGAAAGGGGTGG - Intergenic
1097501485 12:60409628-60409650 GGGCATGCTGATGCATGGGGTGG + Intergenic
1097735868 12:63179973-63179995 GGGCACATTGATGCAAGAGGTGG - Intergenic
1098559046 12:71851744-71851766 GGGCACACTGATGCAAGGGGTGG + Intronic
1098672361 12:73247699-73247721 GGTCATGCTGATGCAAGAGGAGG + Intergenic
1098686151 12:73424158-73424180 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1098944334 12:76573475-76573497 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1099076248 12:78113089-78113111 GGTCATGATTATGCAAGAGGTGG + Intronic
1099229238 12:80003354-80003376 GAGCATGCTGATGCAAGGGGTGG + Intergenic
1099379630 12:81938502-81938524 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1099581364 12:84451217-84451239 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1099607985 12:84829197-84829219 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1099675547 12:85755977-85755999 GGGCATGCTGATGCAAGTGTTGG - Intergenic
1099707923 12:86180570-86180592 GGTCATGCTGATGCAAGAGGTGG - Intronic
1099838551 12:87937626-87937648 GGGCATGCTGATTCAAGAGGTGG - Intergenic
1099899907 12:88695216-88695238 GGGCATGTCGATGTAAGGGGTGG + Intergenic
1099905076 12:88761785-88761807 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1100072174 12:90734633-90734655 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1100147703 12:91698151-91698173 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1100159732 12:91844001-91844023 GGACATACTGATGCAAGGGGTGG - Intergenic
1100164514 12:91901239-91901261 GGATATGCTGATGCAAGGGGTGG - Intergenic
1100657909 12:96667096-96667118 GGCCATGCTGATGCAAGAGGTGG + Intronic
1100674817 12:96855638-96855660 GGGCTTGCTGATGCAAGAGGTGG + Intronic
1100678524 12:96893838-96893860 GGTCATACTAATGCAAGAGGTGG - Intergenic
1101516304 12:105438755-105438777 GGGCATGCCAGTGCAAGGGGTGG + Intergenic
1101692823 12:107097213-107097235 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1102240783 12:111323192-111323214 GGGCACGTGACTGCAAGGAGAGG + Intronic
1103223657 12:119267755-119267777 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104116007 12:125749409-125749431 GGGCACACCAATGCAAGGGGTGG - Intergenic
1104172041 12:126291620-126291642 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1104196036 12:126539127-126539149 GGGGATGTTGATGCAATGGCTGG + Intergenic
1104588026 12:130063038-130063060 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1104750408 12:131234837-131234859 GGGCTTGTTACTGGAAGGAGAGG - Intergenic
1104782312 12:131429625-131429647 GGGCTTGTTACTGGAAGGAGAGG + Intergenic
1105251817 13:18705990-18706012 GGGCATGTTGATGCAAGCTTAGG + Intergenic
1105650470 13:22371910-22371932 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1105916455 13:24921477-24921499 GGGAAGGTTAATACAGGGGGTGG + Intronic
1106106675 13:26739004-26739026 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1106262242 13:28077978-28078000 GGGCATGCTGATGCAAGAGGTGG + Intronic
1106614794 13:31316346-31316368 GGACATGCTGATGCAAGAGGTGG - Intronic
1106631467 13:31479057-31479079 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1106714453 13:32373620-32373642 GGGCATGCTGATATAAGGGGTGG + Intronic
1106718845 13:32418724-32418746 GGTCATGCTGATGCAAGAGGTGG - Intronic
1107039385 13:35933163-35933185 GGCCATGCTGATGCAAGAGGTGG + Intronic
1107330773 13:39296943-39296965 GGGCATGCTGATGCAAGGGTGGG - Intergenic
1107554702 13:41507669-41507691 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1107565973 13:41604932-41604954 GGCAATGTGAAAGCAAGGGGAGG + Intronic
1108184263 13:47872985-47873007 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1108790747 13:53966672-53966694 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1108927462 13:55770302-55770324 GGGCAGGTTGATGCAAGGGCAGG - Intergenic
1109109113 13:58293144-58293166 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1109130110 13:58574521-58574543 GGGCATGCTAATGTAAGAGGTGG + Intergenic
1109337231 13:61008437-61008459 GGTCATGCTGATGCAAGCGGTGG - Intergenic
1109391868 13:61704644-61704666 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1109461802 13:62669842-62669864 GGGTATGTTCATGAAAGGGTTGG + Intergenic
1109476103 13:62882208-62882230 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1109524469 13:63557413-63557435 GGGCATGCTGATGCAAGGTGTGG - Intergenic
1109616270 13:64837526-64837548 GGGCATGCTGATGCAAAGGGTGG - Intergenic
1109749646 13:66672711-66672733 GGTCATGCTGATGCAAGAGGTGG - Intronic
1109823824 13:67692033-67692055 GGTCATGCTAAAGCAAGAGGTGG + Intergenic
1109906307 13:68846360-68846382 AGGCATGCTGATGCAAGGGTTGG - Intergenic
1110007814 13:70294208-70294230 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1110048336 13:70860176-70860198 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1110083325 13:71345443-71345465 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1110157914 13:72341339-72341361 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1110341890 13:74402200-74402222 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1110902122 13:80836929-80836951 GGCCACACTAATGCAAGGGGTGG + Intergenic
1110955283 13:81546207-81546229 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1111078079 13:83264497-83264519 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1111222355 13:85220935-85220957 GGGCACACTGATGCAAGGGGTGG - Intergenic
1111246440 13:85547832-85547854 GGGCATGCTGATGCAGGAGGTGG + Intergenic
1111325765 13:86694558-86694580 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1111372087 13:87332773-87332795 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1111421700 13:88019304-88019326 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1111442997 13:88304809-88304831 GGGCACAATGATGCAAGGGGTGG - Intergenic
1111505418 13:89183401-89183423 GGGCGTGCTGATGCAAGAGGTGG + Intergenic
1111594177 13:90389814-90389836 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1111606596 13:90547183-90547205 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1111609483 13:90584703-90584725 GGTCACGTTGATGCAAGAGGTGG + Intergenic
1111629046 13:90826385-90826407 GGGCACATTGATGCAAGGGGTGG + Intergenic
1111641900 13:90979942-90979964 GGCCATGCTGATGCAAGGAGTGG + Intergenic
1111687164 13:91516456-91516478 GGTCATGCTGATGCAAGAGGTGG + Intronic
1112568152 13:100568982-100569004 GGGCATGCTGATGCAAGAGGTGG + Intronic
1112799263 13:103092634-103092656 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1112824995 13:103382025-103382047 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1112881366 13:104109794-104109816 GGTCATATTGATGCAAGAGGTGG - Intergenic
1113133037 13:107059754-107059776 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1113501808 13:110781815-110781837 AGGTATGCTGATGCAAGGGGTGG + Intergenic
1113881124 13:113627171-113627193 GGGCATGTGAGTGAAAGCGGTGG + Intronic
1114320901 14:21546496-21546518 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1114497479 14:23143019-23143041 GGGTGTGTACATGCAAGGGGAGG + Intronic
1114706957 14:24737321-24737343 GGTCATGCTCATGCAAGAGGTGG + Intergenic
1114778620 14:25514426-25514448 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1114909006 14:27167901-27167923 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1114922026 14:27343759-27343781 GGACATGTTGATGCAAGAGGTGG - Intergenic
1114984605 14:28210735-28210757 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1114986043 14:28230391-28230413 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1115068577 14:29294978-29295000 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1115112533 14:29840959-29840981 GGTCATGCTGATGCAAGAGGTGG - Intronic
1115277361 14:31623068-31623090 GGACATGCTGATGCAAGGGGTGG - Intronic
1115289195 14:31751535-31751557 GGGCATGCTGATGCAAGGGGTGG + Intronic
1115404225 14:32997047-32997069 GGTCATGCTAATGCATGAGGTGG - Intronic
1116024345 14:39497299-39497321 GGGCATGCTGATGTAAGAGGTGG - Intergenic
1116165818 14:41332879-41332901 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116275307 14:42824759-42824781 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1116281488 14:42914472-42914494 GGTCATGCTGATGCAAGTGGTGG + Intergenic
1116356338 14:43936349-43936371 GGTCACGCTAATGCAAGAGGTGG + Intergenic
1116368650 14:44102415-44102437 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1116485576 14:45444391-45444413 GGGCATGTTGATGCAAGGGGTGG - Intergenic
1116564837 14:46432123-46432145 GGTCATGCTGATGCAAGGGATGG + Intergenic
1116625030 14:47253531-47253553 GGGCATGCTGATGCAAGAGGTGG + Intronic
1116642792 14:47486192-47486214 GGTCATGCTGATGCAAGAGGTGG - Intronic
1116669962 14:47828668-47828690 GGGCATGCTGATGCAAGATGTGG + Intergenic
1116714104 14:48406681-48406703 GGACATGCTGATGCAAGAGGTGG + Intergenic
1116742727 14:48776912-48776934 GGGCATGCAGATGCAAGGGGTGG - Intergenic
1117482508 14:56161667-56161689 GGGCATGTTAGTCCCAGGGCTGG - Intronic
1117854120 14:60009922-60009944 GGTCATGCTAATGCAAGAGGCGG + Intronic
1117990203 14:61425370-61425392 GGTCATGTGGATACAAGGGGTGG - Intronic
1118046444 14:61976156-61976178 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1118460150 14:65979957-65979979 GGTCATGCTGATGCAAGAGGTGG - Intronic
1118496033 14:66308887-66308909 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1118524219 14:66621779-66621801 GGTCATGCTGATGCAAGAGGTGG + Intronic
1118963979 14:70562164-70562186 GGGCATGCTGATGCAAGGGATGG - Intergenic
1119463009 14:74826787-74826809 AGGCATCATAATGCAAGGGCAGG + Intronic
1119862703 14:77948033-77948055 GGGCATGCTGATACAAGGAGTGG - Intergenic
1119880634 14:78096926-78096948 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1119934064 14:78574480-78574502 GGGCATGCTGATGCAAGAGGTGG - Intronic
1119963164 14:78882460-78882482 GGGCATGCTGATGCAAGAGGTGG - Intronic
1120091065 14:80333958-80333980 GGTCATGCTGATGCAAGAGGCGG + Intronic
1120132479 14:80823660-80823682 GGTCATGCTGATGCAAGAGGTGG + Intronic
1120257826 14:82142054-82142076 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1120389564 14:83888592-83888614 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1120405003 14:84083821-84083843 GGGCATGCTGATGCAAAGGCTGG + Intergenic
1120469445 14:84903807-84903829 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1120623330 14:86792535-86792557 GGGCGTGTTGATGCAAGGGGTGG - Intergenic
1120658975 14:87230403-87230425 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1120707707 14:87761601-87761623 GGTCATGCTGATGCAAAGGGTGG - Intergenic
1120956815 14:90090257-90090279 GGTCATGCTGATGCAAGAGGTGG - Intronic
1121147078 14:91593440-91593462 GGTCATGCTGATGCAAGAGGTGG - Intronic
1121166581 14:91807456-91807478 GGTCATGCTAATGCAAGAGGTGG - Intronic
1121237877 14:92406199-92406221 GGGCATACTAATGCAAGGGGTGG + Intronic
1121914199 14:97821019-97821041 GGGTATGCTGATGCAAGGGATGG - Intergenic
1122442352 14:101740809-101740831 GAGCATGCTCATGCAAGGAGTGG + Intergenic
1123128190 14:105964774-105964796 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123408713 15:20040930-20040952 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123518044 15:21047640-21047662 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1124226319 15:27897891-27897913 GGTCATGCTGATGCAAGAGGTGG - Intronic
1125225300 15:37389290-37389312 GAGCATGCTGATGCAAAGGGTGG + Intergenic
1125246539 15:37647358-37647380 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1125273917 15:37970834-37970856 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1125279347 15:38027273-38027295 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1126190491 15:45873324-45873346 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1126256147 15:46627684-46627706 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1126273010 15:46844520-46844542 GGGCACGCCAATGCAAGAGGTGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127026733 15:54815174-54815196 GGGCATGCTGATGTAAGAGGTGG - Intergenic
1127144943 15:56014322-56014344 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1127576189 15:60294899-60294921 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1128474359 15:67984472-67984494 GGGCATGATAATGGGAGAGGAGG - Intergenic
1129628984 15:77236322-77236344 GGTCATGCTGATGCAAGAGGTGG - Intronic
1130210727 15:81919242-81919264 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1130762082 15:86831596-86831618 GGTCATGCTGATGCAAGAGGTGG + Intronic
1131556571 15:93404678-93404700 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1131700869 15:94934382-94934404 GGGCAGGCTGATGTAAGGGGTGG + Intergenic
1133045102 16:3083569-3083591 GGGCTCGCTGATGCAAGGGGTGG + Intergenic
1134345663 16:13389011-13389033 GGGGATGTTAATGACAGGGGAGG - Intergenic
1135918977 16:26631442-26631464 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1135925962 16:26694462-26694484 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1136642679 16:31580045-31580067 GGTCATGATGATGCAAGAGGTGG + Intergenic
1136674723 16:31892765-31892787 GGTCATGCTGATGCAAGAGGTGG + Intronic
1137638625 16:50009132-50009154 GGGCATGCTGATGCAGGGGTGGG - Intergenic
1137778623 16:51077746-51077768 GGGCACACTGATGCAAGGGGTGG + Intergenic
1137993765 16:53186232-53186254 GGGCATGCTGATACAAGAGGTGG - Intronic
1138997696 16:62474656-62474678 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1139041380 16:63002491-63002513 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1139113344 16:63919383-63919405 GGTCATGTTGATGCAAGAGGTGG + Intergenic
1139166150 16:64567057-64567079 GGTCATGCTGATGCAAGAGGAGG - Intergenic
1139188285 16:64832926-64832948 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1139491201 16:67286957-67286979 GGGCTTGGTAAGGCATGGGGCGG - Intronic
1141317892 16:82979003-82979025 GGGCATGATGATGCTAGAGGTGG - Intronic
1143210785 17:5185881-5185903 GGTCATGCTGATGCAAGAGGTGG + Intronic
1144225306 17:13139324-13139346 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1145358205 17:22182889-22182911 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1145378111 17:22370613-22370635 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146452682 17:32987245-32987267 GGTCATGCTGATGCAAGAGGTGG + Intronic
1148223922 17:45884832-45884854 GGGAAAGTTAATGTATGGGGGGG + Intergenic
1148390462 17:47268601-47268623 GGTCATATTGATGCAAGAGGTGG + Intronic
1148800929 17:50225350-50225372 GCGCTTGCTGATGCAAGGGGTGG + Intergenic
1149029562 17:52067708-52067730 GGTCATGCTGATGCAAGAGGTGG - Intronic
1149081938 17:52668035-52668057 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1149113575 17:53063611-53063633 GAGCATGCTGATGCAAGAGGTGG - Intergenic
1149145744 17:53490754-53490776 GGGCATGCTGAAGCAAGGAGTGG + Intergenic
1149216144 17:54357175-54357197 GGTCACGTTGATGCAAGAGGTGG + Intergenic
1149308719 17:55373632-55373654 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1149339613 17:55672141-55672163 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1149483142 17:57019530-57019552 GGTGATGCTGATGCAAGGGGTGG + Intergenic
1150515788 17:65808088-65808110 TGGCATGCTGATGCAAGGGGTGG - Intronic
1151086563 17:71387645-71387667 GGAAATGCTAATGCAAAGGGTGG + Intergenic
1151451760 17:74202440-74202462 GAGCTTGTTAATGGAAGGGCAGG + Intergenic
1151480871 17:74369449-74369471 GAGCCTGTTAGTGCAGGGGGCGG - Exonic
1152141180 17:78537690-78537712 GGGCAGGTTGGGGCAAGGGGAGG + Intronic
1153011886 18:546997-547019 GGCCATGCTGATGCAAGAGGTGG + Intergenic
1153333939 18:3902632-3902654 GGTCATGCTAATGCACGGTGGGG - Intronic
1153506411 18:5803826-5803848 GGGCATGCTGATGCAAGGAGTGG - Intergenic
1153685218 18:7538430-7538452 GGGCATGCTGAAGCAAGGGGTGG + Intergenic
1155463830 18:26114018-26114040 AGGCATGCTGATACAAGGGGTGG - Intergenic
1155516066 18:26624922-26624944 GGTCATGCTGATGCAAGAGGTGG - Intronic
1155665832 18:28307330-28307352 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1155795852 18:30035553-30035575 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1155818578 18:30347337-30347359 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1156078480 18:33308231-33308253 GGGCATGCTGTTGCAAGAGGTGG - Intronic
1156122621 18:33863610-33863632 GGGCATGCTGATGCACAGGGTGG + Intronic
1156169300 18:34463078-34463100 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1156322396 18:36038753-36038775 GGGCACACTGATGCAAGGGGTGG - Intronic
1156809131 18:41225322-41225344 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1157077320 18:44479831-44479853 GGGTGTGCTGATGCAAGGGGTGG - Intergenic
1157195117 18:45614586-45614608 GGTCATGCTGATGCAAGAGGTGG - Intronic
1157843013 18:50977007-50977029 GGGCATGCTGATGCAAGAGGTGG + Intronic
1158056417 18:53285826-53285848 GGTCATGCTGATGCAAGAGGTGG - Intronic
1159083500 18:63761165-63761187 GGTCATGCTGATGCAAGAGGTGG - Intronic
1159555570 18:69941459-69941481 GGGCATGCTGATGCAAGAGGTGG - Intronic
1159643273 18:70888154-70888176 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1159756395 18:72371069-72371091 GGGCATGCTGATGCAAGAAGTGG - Intergenic
1159805784 18:72957172-72957194 GGTCATGCTAATGAAAGTGGAGG + Intergenic
1159960289 18:74550252-74550274 GGGCACTTTGCTGCAAGGGGTGG - Intronic
1159996556 18:74970601-74970623 GGTCATGCTGATGCAAGAGGTGG + Intronic
1160082093 18:75737387-75737409 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1160999107 19:1900390-1900412 GGGTATGTAAAAGAAAGGGGAGG + Intergenic
1162002814 19:7758112-7758134 GGGCACGCTGATGCAAGAGGTGG - Intergenic
1162593151 19:11606392-11606414 GGTCATGCTGATGCAAGAGGTGG + Intronic
1163539766 19:17900894-17900916 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1164447452 19:28330127-28330149 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1164541403 19:29124134-29124156 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1164665475 19:30030741-30030763 GGGGATGTTGATGATAGGGGAGG - Intergenic
1165974722 19:39665756-39665778 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1166410103 19:42550953-42550975 GGTCATGCTGATGCAAGAGGGGG - Intronic
1166526470 19:43513453-43513475 GGTCATGCTGATGCAAGAGGTGG - Intronic
1167379319 19:49129475-49129497 GGGAATTTGAATCCAAGGGGAGG + Intronic
1168516463 19:57013547-57013569 GGGCACACTCATGCAAGGGGTGG - Intergenic
924993704 2:338330-338352 GGTCATGCTAATGAAAGAGGTGG - Intergenic
925291993 2:2754187-2754209 GGTCATGCTCATGCAAGAGGTGG - Intergenic
925354471 2:3228232-3228254 GGTCATGCTGATGCAAGAGGTGG - Intronic
925473954 2:4192300-4192322 GGGCATGCTGATGCAAGAGGTGG + Intergenic
925494795 2:4435107-4435129 GGGCATTCTGATACAAGGGGTGG + Intergenic
925594822 2:5544685-5544707 AGGGATGCTGATGCAAGGGGTGG - Intergenic
925805569 2:7644780-7644802 GGTCATGATGATGCAAGAGGTGG + Intergenic
925816970 2:7763329-7763351 GGTCATGTTGATGCAAGAGGTGG + Intergenic
926067808 2:9858303-9858325 AGGCATGCTGATGCAAGGGGTGG + Intronic
926280523 2:11442335-11442357 GGTGATGTTGATGCAAGAGGTGG + Intergenic
926484516 2:13438140-13438162 GAGCATGCTGATGCAAGAGGTGG + Intergenic
926526813 2:13991771-13991793 GGTCATGCTGATGCAAGAGGTGG + Intergenic
926598315 2:14814414-14814436 GGGCATGCTGATGCAAAGGGTGG - Intergenic
926718352 2:15941715-15941737 GGGCATGCAGATGCAGGGGGTGG - Intronic
927302895 2:21536277-21536299 GGGCATGCTGATGCAAGAGGTGG - Intergenic
927329191 2:21842125-21842147 GGGCATGCTAATGCAAGAGGTGG - Intergenic
927380795 2:22476977-22476999 GGTCATGTTGTTGCAAGAGGTGG - Intergenic
928048950 2:27968727-27968749 GGTCATGCTGATGCAAGAGGTGG - Intronic
928474639 2:31614385-31614407 GGTCATGCTGATGCAAGTGGTGG + Intergenic
928492400 2:31797330-31797352 TGGCATGTTTTTGCAATGGGTGG - Intergenic
928594346 2:32845914-32845936 GGTCATGCCAATGCAAGAGGTGG - Intergenic
928696263 2:33853082-33853104 GGGCATACTAGTGCAAGGGATGG + Intergenic
928812617 2:35247784-35247806 GGTCATGCTGATGCAAGAGGTGG + Intergenic
929391315 2:41471885-41471907 GGGCATACTGATGCAAGGGGTGG - Intergenic
929612893 2:43284850-43284872 GGGCATGCTGATGCAGGGAGTGG - Intronic
930119534 2:47748678-47748700 GGGCATACTGTTGCAAGGGGTGG - Intronic
930299266 2:49594404-49594426 GGGCATGCCGATGCAAAGGGTGG - Intergenic
930456669 2:51614831-51614853 GGTCATGCTGATGCAAGAGGTGG + Intergenic
930512155 2:52358913-52358935 GGTCATGTTGATGCAAGAAGTGG - Intergenic
931154174 2:59608574-59608596 GGGCATGCTGATGCAAGGGGTGG - Intergenic
931162179 2:59704258-59704280 GGGCATGCTGATGCAAGGCATGG + Intergenic
931272195 2:60712901-60712923 GGTCATGCTGATGCAAGAGGTGG - Intergenic
932317955 2:70798706-70798728 GGTCATGCTGATGCAAGAGGTGG + Intergenic
932923369 2:75942323-75942345 GGCCATGCTAATGGAAGAGGTGG - Intergenic
933031474 2:77333948-77333970 GGTCATGTTGATGCAACAGGCGG - Intronic
933065090 2:77782150-77782172 GGTCATGTTGATGCAAGAAGTGG - Intergenic
933070960 2:77857475-77857497 GGGCAAGCTAATGCAAGAGATGG - Intergenic
933344443 2:81065714-81065736 GGTCATGCTGATGCAAGAGGTGG + Intergenic
934015837 2:87881069-87881091 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015842 2:87881090-87881112 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015847 2:87881111-87881133 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934700911 2:96439317-96439339 GGTCATGTTGATGCAAGAGATGG - Intergenic
934940452 2:98497766-98497788 GGTCATGCTGATGCAAGAGGTGG - Intronic
935419678 2:102854282-102854304 GGTCATGCTGATGCAAGAGGTGG + Intergenic
936014454 2:108947214-108947236 GGGCATGCTGATGCAAGGGGTGG + Intronic
936499488 2:113054819-113054841 GGTCATGCTTATGCAAGAGGTGG + Intergenic
936753769 2:115678833-115678855 GGGCATGCTGATGCAAGAGGTGG - Intronic
937008978 2:118544506-118544528 GGTCATGCTGATGCAAGAGGTGG - Intergenic
937491328 2:122371354-122371376 GGGCATGCTGATGGAAGAGGTGG + Intergenic
937935634 2:127241848-127241870 GGTCATGCTGATGCAAGTGGGGG + Intergenic
939023574 2:136985883-136985905 GGGCACGCTGATGCAAGGAGTGG - Intronic
939037454 2:137149609-137149631 GGTCATGCTGATGCAAGAGGTGG - Intronic
939137560 2:138315278-138315300 GGTCATGCTGATGCAAGAGGTGG + Intergenic
939361302 2:141175891-141175913 GGGCATGCTGATACAAGGGGTGG - Intronic
939782960 2:146472989-146473011 GGGCATGCCGATGCAAGGGGTGG - Intergenic
939826695 2:147024038-147024060 GGACATGCTGATGCAAGGAGTGG + Intergenic
939847728 2:147268579-147268601 GGTCATGCTGATGCAAGAGGTGG + Intergenic
939852999 2:147321808-147321830 GGGCATGCTGATGCAAGAGGTGG - Intergenic
939918102 2:148073357-148073379 GGGGATATTAATATAAGGGGTGG + Intronic
939956478 2:148531774-148531796 GGGGGTGTTAATGCAAGAGCAGG + Intergenic
940387080 2:153085966-153085988 GGGCATGCTGATGCAAGAGGCGG - Intergenic
940408852 2:153336411-153336433 GGTCATGCTGATGCAAGAGGTGG - Intergenic
940712216 2:157176242-157176264 GGTCATGCTGATGCAAGAGGTGG - Intergenic
940729755 2:157375428-157375450 GGGCACTTTGATGCAAAGGGTGG + Intergenic
940785897 2:157980742-157980764 GGTCATGCTGATGCAAGAGGTGG - Intronic
941165431 2:162078594-162078616 AGTCATGCTAATGCAAGAGGTGG + Intergenic
941307710 2:163891949-163891971 GGTCATGCTGATGCAAGAGGTGG + Intergenic
941337995 2:164268556-164268578 GGCCATGCTGATGCAAGAGGTGG - Intergenic
941445283 2:165592103-165592125 GGGCATGCTGATGCAAGAGGTGG - Intronic
941513080 2:166437693-166437715 GGGCATGCTGATGGAAGAGGTGG - Intronic
941527031 2:166618684-166618706 GGTCATGCTGATGCAAGAGGTGG - Intergenic
941560351 2:167036371-167036393 GGCCATGCTGATGCAAGAGGTGG - Intronic
941741957 2:169044610-169044632 GGTCATGCTGATGCAAGAGGTGG - Intergenic
941977801 2:171424497-171424519 GGGCATGCTGATACAAGAGGTGG - Intronic
942733299 2:179082424-179082446 GGTCATGCTGATGCAAGAGGTGG + Intergenic
942803530 2:179903095-179903117 GGGCAGACTGATGCAAGGGGTGG + Intergenic
942825387 2:180169389-180169411 GAGCATGCTGATGCCAGGGGTGG + Intergenic
943248413 2:185485189-185485211 GGTCATGCTTATGCAAGAGGTGG - Intergenic
943315733 2:186385693-186385715 GGGCATGCTGATGCAAGATGTGG + Intergenic
943493363 2:188585165-188585187 GGGCATGCTAATGCAAGGGATGG + Intronic
944011393 2:194979204-194979226 GGTCATACTAATGCAAGAGGTGG + Intergenic
944101297 2:196030769-196030791 GGTCATGCTGATGCAAGAGGTGG + Intronic
944272743 2:197802162-197802184 GGGACTGTTAATGCAGGGGTAGG + Intergenic
944371130 2:198985190-198985212 GGCCATGCTGATGCAAGAGGTGG + Intergenic
944470260 2:200045547-200045569 GGGCATGCTGATGCAAGGGGTGG + Intergenic
944921084 2:204413521-204413543 GGTCATGCTGATGCAAGAGGTGG - Intergenic
945041705 2:205748084-205748106 GGGCGTGTAAATGAAAGTGGAGG - Intronic
945109501 2:206349019-206349041 GGACATGCTGATGCAAGAGGTGG + Intergenic
945166590 2:206953483-206953505 GGTCATGCTGATGCAAGAGGTGG + Intronic
945360187 2:208887081-208887103 GGTCATGCTGATGCAAGAGGTGG - Intergenic
945593881 2:211768197-211768219 GGTCACGTTGATGCAAGAGGTGG + Intronic
946317078 2:218923501-218923523 GGGCATGCTGATGCAAGAGGTGG + Intergenic
946515058 2:220402702-220402724 GGGCATGCAGGTGCAAGGGGTGG - Intergenic
946575501 2:221071430-221071452 GGTCATGCTGATGCAAGGGGTGG + Intergenic
946968694 2:225067887-225067909 GGGAATGCTGATGCAAGGGATGG - Intergenic
947396757 2:229694542-229694564 GGTCATGCTGATGCAAGAGGTGG - Intronic
947888613 2:233595984-233596006 GGTCATGTTGATGCAAGAGGTGG - Intergenic
947951575 2:234152438-234152460 GGTCATGCTGATGCAAGGGGTGG + Intergenic
948116353 2:235496218-235496240 GGACTTGTTAATTCCAGGGGAGG + Intronic
948292356 2:236835247-236835269 AGGCATGCTGATGCAAGGGGTGG + Intergenic
948878991 2:240846259-240846281 GGTCATGCTTATGCAAGAGGTGG - Intergenic
948911627 2:241007922-241007944 GGGCAGTTTATTGCAAGGGAGGG - Intronic
1169082810 20:2807430-2807452 AGGGATTTTAATGTAAGGGGTGG + Intergenic
1169643072 20:7776870-7776892 GGTCATGCTGATGCAAGAGGGGG - Intergenic
1170065219 20:12303424-12303446 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1170079067 20:12451122-12451144 GGTCATGTCGATGCAAGAGGTGG - Intergenic
1170337027 20:15281602-15281624 GGTCATGCTGATGCAAGAGGTGG + Intronic
1170499566 20:16960911-16960933 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1170750284 20:19139218-19139240 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1170875216 20:20244023-20244045 GGTCATGCTGATGCAAGAGGTGG + Intronic
1172720312 20:36994936-36994958 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1172893122 20:38281181-38281203 GGTCATACTGATGCAAGGGGTGG + Intronic
1173023600 20:39287770-39287792 GGTCATGCTGATGCAAGAGGAGG - Intergenic
1175013539 20:55764418-55764440 GTGCTTGCTGATGCAAGGGGTGG + Intergenic
1175255716 20:57645687-57645709 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1176688980 21:9881501-9881523 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1176791347 21:13323319-13323341 GGTCATGCTAATGCCAGAGGTGG - Intergenic
1176837343 21:13805876-13805898 GGGCATGTTGATGCAAGCTTAGG + Intergenic
1176935305 21:14860460-14860482 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1177085188 21:16694721-16694743 GGGCACATTAATGCAAGGGATGG + Intergenic
1177130496 21:17248810-17248832 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1177236071 21:18391507-18391529 CGGCATGCTAATGCAAGGGGTGG + Intronic
1177267079 21:18798844-18798866 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1177305998 21:19317003-19317025 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1177328813 21:19629380-19629402 GGGCATGCTGATTCAAAGGGTGG - Intergenic
1177358416 21:20037974-20037996 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1177401794 21:20614366-20614388 GGACATGCTGATGCAAGGGGTGG - Intergenic
1177487432 21:21777682-21777704 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1177517717 21:22176844-22176866 GGCCACACTAATGCAAGGGGTGG - Intergenic
1177529089 21:22337261-22337283 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1177604422 21:23359826-23359848 AGGCATGCTGATGCAAGAGGTGG + Intergenic
1177742234 21:25168198-25168220 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1177803301 21:25849055-25849077 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1177838083 21:26207760-26207782 GAGCCTATTAATGTAAGGGGGGG + Intergenic
1177839351 21:26218631-26218653 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1177965349 21:27719998-27720020 GGGCACATTGTTGCAAGGGGTGG - Intergenic
1178013764 21:28318260-28318282 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1178178516 21:30132593-30132615 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1178198853 21:30379708-30379730 GGACACGCTGATGCAAGGGGTGG - Intronic
1178261803 21:31106790-31106812 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1178338679 21:31766619-31766641 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1179332134 21:40413413-40413435 GGTCATGCTGATGCAAGAGGTGG - Intronic
1179453568 21:41482302-41482324 GGGCAGGATAATACATGGGGTGG + Intronic
1180141019 21:45893386-45893408 GGGCTTGTTAATGCATGGGATGG + Intronic
1181445354 22:22968521-22968543 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1182815722 22:33161683-33161705 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1182816875 22:33172031-33172053 GGGCAGGCTGATGCAAGAGGTGG - Intronic
1182887731 22:33789642-33789664 GGTCATGCTGATGCAAGAGGTGG - Intronic
1182999650 22:34844482-34844504 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1183847442 22:40553926-40553948 GGTCATGTTGATGCAGGAGGTGG - Intronic
1184157685 22:42679098-42679120 GGTCATGCTGATGCAAGAGGTGG - Intergenic
949230370 3:1743707-1743729 GGGCATGCTAATTCAAGAGGTGG + Intergenic
949464344 3:4329041-4329063 GGTCATGCTGATGCAAGAGGTGG + Intronic
949635905 3:5981347-5981369 GGTCATGCTGATGCAAGAGGTGG + Intergenic
949662104 3:6291587-6291609 GGTCATGCTGATGCAAGAGGTGG + Intergenic
949721764 3:6998309-6998331 GGTCATGCTGATGCAAGAGGTGG + Intronic
950244945 3:11407277-11407299 GGTCATGCTGATGCAAGAGGTGG + Intronic
951100692 3:18684608-18684630 GGGCATTCTGATGCAAGGAGTGG - Intergenic
951199646 3:19862850-19862872 GGTCATGCTAATTCAAGAGGTGG + Intergenic
951773438 3:26283511-26283533 GGTCATGCTGATGCAAGAGGTGG + Intergenic
951794074 3:26518236-26518258 GGTCATGCTGATGCAAGAGGTGG - Intergenic
952202603 3:31147176-31147198 GGTCATGCTGATGCAAGAGGTGG + Intergenic
952221330 3:31326988-31327010 GGGCACACTGATGCAAGGGGTGG + Intergenic
952589415 3:34932662-34932684 GGTCATGTTGATACAAGAGGTGG - Intergenic
952715009 3:36471736-36471758 GGCCATGCTGATGCAAGAGGTGG + Intronic
952734975 3:36680603-36680625 GGGCACACTGATGCAAGGGGTGG + Intergenic
952739775 3:36724067-36724089 GGTCACGCTAATGCAAGAGGTGG - Intronic
952939645 3:38432750-38432772 GGTCATGCTGATGCAAGAGGTGG + Intergenic
953132596 3:40154700-40154722 GGGCTTGTCAAGGCAGGGGGAGG - Intronic
953446698 3:42974527-42974549 GGTCATGTTGACGCAAGAGGTGG - Intronic
954002334 3:47567348-47567370 GTGCATGTTACTGCAGAGGGCGG + Intronic
956391697 3:68780002-68780024 GGTCATGCTGATGCAAGAGGTGG - Intronic
956475018 3:69610408-69610430 GGTCATGCTGATGCAAGAGGTGG - Intergenic
956910100 3:73808020-73808042 GGACATGCTGATGCAAGAGGTGG - Intergenic
956911453 3:73821960-73821982 GGTCATGCTGATGCAAGAGGTGG - Intergenic
957105581 3:75883315-75883337 GGTCATGCCAATGCAAGAGGTGG + Intergenic
957148660 3:76457406-76457428 GGTTATGCTAATGCAAGAGGTGG + Intronic
957160228 3:76601106-76601128 GGTCATGCTGATGCAAGAGGTGG + Intronic
957260564 3:77896798-77896820 GGTCATGCTGATGCAAGGGGTGG + Intergenic
957267149 3:77982494-77982516 TGTCATGCTAATGCAAGAGGTGG + Intergenic
957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG + Intergenic
957477064 3:80739097-80739119 GGGCATGCTGATGCAAAGGGTGG + Intergenic
957557464 3:81780451-81780473 GGTCATGGTGATGCAAGAGGTGG + Intergenic
957609536 3:82449360-82449382 GGGCATGCTGATGCAAGGGGTGG - Intergenic
957625269 3:82646981-82647003 GGTCATGCTGATGCAAGAGGTGG - Intergenic
957662896 3:83184103-83184125 GGTCATGCTGATGCAAGAGGTGG - Intergenic
957929817 3:86863383-86863405 GGTCATGTTGATGCAAGAGATGG - Intergenic
957956637 3:87196403-87196425 GGGCACGTTGATGCAAGAGTTGG - Intergenic
957978264 3:87474668-87474690 GGGCATGCTGATGCAAGAGGTGG - Intergenic
958005175 3:87801564-87801586 GGGCATCTTGAAGCAAGGGCAGG + Intergenic
958006095 3:87813231-87813253 GGGCACGCTGATGCAAGGGATGG - Intergenic
958018461 3:87969396-87969418 GGTCATGCTGATGCAAGAGGTGG - Intergenic
958066010 3:88545366-88545388 GGTCATGCTGATGCAAGAGGTGG - Intergenic
958067532 3:88563496-88563518 GTGCATGCTGATGCAAGAGGTGG + Intergenic
958083776 3:88780298-88780320 GGGCACACTAATGCAAGAGGTGG + Intergenic
958474987 3:94569180-94569202 GGGCATGCTAATGCAAGGGGTGG - Intergenic
958475012 3:94569328-94569350 GGGCACACTAATGCAAGAGGTGG - Intergenic
958553248 3:95643180-95643202 GGTCATGCTGATGCAAGAGGTGG + Intergenic
958600400 3:96289290-96289312 GGTCATGCTGATGCAAGAGGTGG - Intergenic
958638974 3:96780161-96780183 GGTCACGTTGATGCAAGAGGTGG - Intergenic
958646512 3:96881930-96881952 GGTCATGTTTATGTAAGAGGTGG + Intronic
958650016 3:96926737-96926759 GGACATGCTGATGCAAGGGGTGG + Intronic
958823409 3:99002347-99002369 GGTCATGCTGATGCAAGAGGTGG + Intergenic
958831826 3:99099120-99099142 GGTCATGCTGATGCAAGAGGTGG - Intergenic
958935400 3:100250769-100250791 GGACATGCTAATGCAAGAAGTGG + Intergenic
959023483 3:101214479-101214501 GGGCATGCTGATGCAGGAGGTGG - Intergenic
959054518 3:101554126-101554148 GGTCATGCTGATGCAAGAGGTGG - Intergenic
959299367 3:104578433-104578455 GGTCATGCTGATGCAAGAGGTGG + Intergenic
959305957 3:104666278-104666300 GGGCACATTGATGCAAGAGGTGG - Intergenic
959507462 3:107171704-107171726 GGGCATGCTGATGCAAGGGATGG - Intergenic
959507983 3:107176596-107176618 GGGCACACTGATGCAAGGGGTGG - Intergenic
959695617 3:109246202-109246224 GGTCACGCTAATGCAAGAGGTGG + Intergenic
959729945 3:109590263-109590285 GGTCATGCTGATGCAAGAGGTGG + Intergenic
959732252 3:109618096-109618118 GGGCATGAAAATGCAAGGGTGGG - Intergenic
959777714 3:110188429-110188451 GGGCATGCTGATGCAAAGGGTGG + Intergenic
959788461 3:110329318-110329340 GGGCACGCTGATGCAAGGGGTGG - Intergenic
960021883 3:112964428-112964450 GGTCATGCTGATGCAAGAGGAGG - Intronic
960496808 3:118384469-118384491 GGTCATGCTGATGCAAGAGGTGG - Intergenic
960542020 3:118871747-118871769 GGGCACACTAATGCAAGGGGTGG - Intergenic
960563784 3:119113528-119113550 GGCCATGTTGATGCAACAGGTGG + Intronic
960858070 3:122123281-122123303 GGTCATGCTGATGCAAGAGGTGG - Intergenic
961054201 3:123774058-123774080 GGGCATGGAAAAGCAAGGAGAGG + Intronic
961315062 3:126028807-126028829 GGGCACATTGGTGCAAGGGGTGG - Intronic
962045837 3:131758291-131758313 GGTCATGTTGATGCAAGAGGTGG - Intronic
963391735 3:144673671-144673693 TGGCAAGTTTATGCAAGGTGTGG - Intergenic
963422022 3:145073004-145073026 GGTCATGTAGATGCAAGAGGTGG + Intergenic
963471547 3:145748073-145748095 GGGCATGATGATACAAGGGGTGG + Intergenic
963475106 3:145794478-145794500 GGTCATGCTGATGCAAGAGGTGG + Intergenic
963494788 3:146045349-146045371 GGGCATGCTTATGTAAGGGGTGG + Intergenic
963619917 3:147593982-147594004 GGGCCTGTTAATGGGTGGGGGGG - Intergenic
963878263 3:150500868-150500890 GGGCATGCTGATGCAAGAGGTGG + Intergenic
963996525 3:151716575-151716597 GGGCATGCTGATGCAAGGGATGG + Intergenic
964026387 3:152079673-152079695 AGGCATGCTGATGCAAGGGGTGG + Intergenic
964241577 3:154601033-154601055 GGGCATGCTGGTGCAAGGAGTGG + Intergenic
964267876 3:154920948-154920970 GGGCATGCTGATTCAAGGGGTGG + Intergenic
964853438 3:161119434-161119456 GGGCATGCTGATGCAAGAGGTGG - Intronic
964926471 3:161964007-161964029 GGTCATGTTGATGCACGAGGTGG - Intergenic
964933952 3:162059241-162059263 GTGCACGCTGATGCAAGGGGTGG + Intergenic
964974923 3:162606589-162606611 GGGCATGCTGATGTAAGGGGTGG - Intergenic
965066693 3:163858423-163858445 GGGCATGCTGATGCAAGAGGTGG - Intergenic
965086845 3:164111500-164111522 GGCCATGCTGATGCAAGAGGTGG + Intergenic
965092541 3:164181414-164181436 GGTCATGCTGATGCAAGAGGTGG + Intergenic
965275418 3:166676733-166676755 GGTCATGCTGATGCAAGAGGTGG + Intergenic
965349693 3:167597671-167597693 GGGCATGCTAAAGCAAGGGGTGG - Intronic
965386956 3:168056607-168056629 GGTCATGCTGATGCAAGAGGTGG - Intronic
965662188 3:171053250-171053272 GGTCATGCTGATGCAAGAGGTGG - Intergenic
965795260 3:172432732-172432754 GGTCATGCTGATGCAAGAGGTGG + Intergenic
965864133 3:173183735-173183757 GGTCATGCTGATGCAAGAGGTGG - Intergenic
965931036 3:174043607-174043629 GGTCATGCTGATGCAAGAGGTGG + Intronic
965983888 3:174727652-174727674 GAGGATGTTGATGCCAGGGGAGG - Intronic
965990474 3:174811391-174811413 GGGCATACTGGTGCAAGGGGTGG - Intronic
966446506 3:180007293-180007315 GGTCATGCTGATGCAAGAGGTGG + Intronic
966512121 3:180776114-180776136 GGTCATGCTGATGCAAGAGGTGG + Intronic
966665127 3:182463631-182463653 GGTCATGCTGATGCAAGAGGTGG - Intergenic
967154927 3:186683585-186683607 GGTCATGCTGATGCAAGAGGTGG + Intergenic
967513602 3:190340974-190340996 GGTCATGCTGATGCAAGAGGTGG + Intronic
967567461 3:190988835-190988857 GGGCATGCTGATGCAAAGGGTGG - Intergenic
967592990 3:191299890-191299912 GGGCACATTGATGCAAGGAGTGG - Intronic
967749921 3:193101801-193101823 GGTCATGGTGATGCAAGGAGTGG - Intergenic
968295203 3:197571032-197571054 GGTCATGCTGATGCAAGAGGTGG - Intronic
968392295 4:203559-203581 GGTCATGCTGATGCAAGAGGTGG - Intergenic
968695789 4:2025717-2025739 GGGCATGCTGATGCAAGGGGTGG + Intronic
968892801 4:3380232-3380254 GGGCATGCTGATGCAAGAGGTGG + Intronic
969103680 4:4789059-4789081 GGGCATGCTGATGCAAGAGGTGG - Intergenic
969904732 4:10383375-10383397 GGTCATGCTGATGCAAGAGGTGG - Intergenic
970047772 4:11875718-11875740 GGGCATGCTGATGCAAGGGGTGG + Intergenic
970049564 4:11898092-11898114 GGTCATGCTGATGCAAGAGGTGG - Intergenic
970057727 4:11994224-11994246 GGGCATGCTGATGCAAGAGGTGG - Intergenic
970100430 4:12515121-12515143 GGGCATATTGATGCAAGGGGTGG - Intergenic
970222587 4:13825757-13825779 GGTCATGCTGATGCAAGAGGTGG - Intergenic
970659156 4:18264813-18264835 GGGCCTGCTGATGCAAGGGGTGG + Intergenic
970704372 4:18782691-18782713 GGGCATGCTGGTGCAGGGGGAGG + Intergenic
970756914 4:19437708-19437730 GGGCACGCTGATGCAAGAGGTGG - Intergenic
970758071 4:19450578-19450600 GGGCACATTGATGCAAGAGGTGG + Intergenic
970818999 4:20191096-20191118 GGTCATGCTGATGCAAGAGGTGG - Intergenic
970868105 4:20782119-20782141 GGTCATGCTGATGCAAGAGGTGG + Intronic
971119706 4:23689851-23689873 GGGCATGCTGATGCAAGAGGTGG - Intergenic
971126464 4:23760586-23760608 GGTCATGCTGATGCAAGAGGTGG + Intronic
971499185 4:27300308-27300330 GGTCACGCTGATGCAAGGGGTGG + Intergenic
971561466 4:28084083-28084105 GGTCATGCTGATGCAAGAGGTGG + Intergenic
971684405 4:29746387-29746409 GGCCATGCTGATGCAAGGGCTGG + Intergenic
971831787 4:31704533-31704555 GGTCATGCTGATGCAAGAGGTGG + Intergenic
971840998 4:31851561-31851583 GGGCAAGCTGATGCAAGAGGTGG - Intergenic
971892678 4:32544792-32544814 GGGCATGCTGATGCAACAGGTGG - Intergenic
971939848 4:33200315-33200337 GGGCTTGTTGATGCAAGAGGTGG - Intergenic
971943548 4:33245628-33245650 GGGCATGCTGATGCAAGGGGTGG + Intergenic
972002616 4:34058209-34058231 GGTCATGTTAATGTAAGAGGTGG + Intergenic
972051621 4:34742707-34742729 GGTCACGTTGATGCAAAGGGTGG + Intergenic
972100415 4:35408025-35408047 GGTCATGCTGATGCAAGAGGTGG - Intergenic
972103030 4:35446061-35446083 GGTCATGCTGATGCAAGAGGTGG - Intergenic
972367867 4:38392947-38392969 GGGCACATTGTTGCAAGGGGTGG - Intergenic
972844353 4:42970107-42970129 GGGTATGCTAATGCAAGGGGTGG + Intronic
972880509 4:43417095-43417117 GGGCATGCTGATACAAAGGGTGG + Intergenic
972894467 4:43602570-43602592 GGGCATGCTGATGAAAGGGGTGG - Intergenic
973078544 4:45961705-45961727 GGTCATGCTGATGCAAGAGGTGG + Intergenic
973552301 4:52048147-52048169 GGTCATGCTGATGCAAGAGGTGG + Intergenic
973582291 4:52356353-52356375 TGACATGGTAATGCAAGGGCTGG - Intergenic
974110947 4:57524389-57524411 GGTCATGCTGATGCAAGAGGTGG - Intergenic
974206168 4:58705577-58705599 GGTAATGCTGATGCAAGGGGTGG - Intergenic
974271061 4:59651948-59651970 GGTCATGCTGATGCAAGAGGTGG - Intergenic
974310931 4:60209310-60209332 GGGCATACTGATGCAAGGGATGG + Intergenic
974457456 4:62146083-62146105 TGGCACGTTAATGCAAGGGGTGG - Intergenic
974487628 4:62525300-62525322 GGTCACGTTGATGCAAGAGGTGG - Intergenic
974517529 4:62936554-62936576 GGTCATGCTGATGCAAGAGGTGG - Intergenic
974555776 4:63445853-63445875 GGTCATGTTGATGCAAGAGGTGG + Intergenic
974608397 4:64183586-64183608 GGGCTTGCTGATTCAAGGGGTGG + Intergenic
974614681 4:64266243-64266265 GGTCATGCTGATGCAAGAGGTGG + Intergenic
974666483 4:64969185-64969207 GGACATGCTTATGCAAAGGGTGG + Intergenic
974867424 4:67597639-67597661 GGGCACACTGATGCAAGGGGTGG - Intronic
974931506 4:68365823-68365845 GGTCATGCTGATGCAAGGGGTGG - Intergenic
974963291 4:68730408-68730430 GGTCATGCTGATGCAAGAGGAGG + Intergenic
975253913 4:72212696-72212718 GGTCATGCTGATGCAAGAGGTGG + Intergenic
975456551 4:74597635-74597657 GGTCACGCTAATGCAAGAGGTGG - Intergenic
975627057 4:76360542-76360564 GGGCATGCTGATGTAAGGGGTGG - Intronic
975796618 4:78012742-78012764 GGTCATGCTGATGCAAGAGGTGG - Intergenic
976070170 4:81231763-81231785 GGGTATGCTGATGCAACGGGTGG - Intergenic
976142034 4:82002741-82002763 GGCCACACTAATGCAAGGGGTGG - Intronic
976286371 4:83375147-83375169 GGTCATGCTGATGCAAGAGGTGG + Intergenic
976706772 4:88027290-88027312 CTCCATGCTAATGCAAGGGGTGG - Intronic
976853482 4:89576187-89576209 GGGCATGATGATGCAAGAGGTGG - Intergenic
977005996 4:91570134-91570156 GGTCATGCTGATGCAAGAGGTGG + Intronic
977189197 4:93978229-93978251 GGTCATGCTGATGCAAGAGGTGG - Intergenic
977368315 4:96101723-96101745 GGGCATGCTGATACAAGGGGTGG - Intergenic
977396624 4:96479074-96479096 GGGAATGCTGATGCAAGGGGTGG - Intergenic
977416046 4:96733852-96733874 AAGCATGCTAATGCAAGAGGTGG - Intergenic
977417219 4:96748997-96749019 GGTCATGCTGATGCAAGAGGTGG + Intergenic
977579127 4:98705203-98705225 GGTCATGTTGATGCAAGAGGTGG - Intergenic
977722081 4:100250835-100250857 GGGCATGCTGAGGCAAGGGGTGG + Intergenic
978252527 4:106649997-106650019 GGTCATGCTGATGCAAGAGGTGG - Intergenic
978256030 4:106693857-106693879 GGGCATGCTGATGCAAGAGGTGG - Intergenic
978267001 4:106839085-106839107 GGGCATACTGGTGCAAGGGGTGG + Intergenic
978492391 4:109323022-109323044 GGGCATGCTGATGCAAGAAGTGG + Intergenic
978696276 4:111584154-111584176 GGGAATGCTGATGCAAGGGGTGG + Intergenic
978774289 4:112490452-112490474 GGTCATGCTAATGCAAGATGTGG + Intergenic
978809811 4:112837649-112837671 GGGAATGCTGATGCAAGGGGTGG - Intronic
979063607 4:116098729-116098751 GGTCACGCTAATGCAAGAGGTGG - Intergenic
979097798 4:116573348-116573370 GGTCATGCTAATGCAAGAAGTGG + Intergenic
979146216 4:117251789-117251811 GGTCATGTTGATGAAAGAGGTGG - Intergenic
979173144 4:117626570-117626592 TGTCATGCTAATGCAAGAGGTGG - Intergenic
979362673 4:119783297-119783319 GGGCATGCTGATGCAAAGGGTGG + Intergenic
979369163 4:119862802-119862824 GGTCATGCTGATGCAAGAGGTGG + Intergenic
979500427 4:121434098-121434120 GGTCATGCTGATGCAAGAGGTGG + Intergenic
979699957 4:123656370-123656392 GGGCATGCCGATGCAAGAGGTGG + Intergenic
979702993 4:123689010-123689032 GGGCACACTGATGCAAGGGGTGG + Intergenic
979805070 4:124961021-124961043 GGGCATGCTGATGCAAAGGGTGG + Intergenic
979881874 4:125970478-125970500 GAGCATGCTGATGCAAGAGGTGG + Intergenic
979885727 4:126025278-126025300 GGGTGTGCTAATGCAAGAGGTGG - Intergenic
979948130 4:126860015-126860037 GGGCATGCTGATGAAAGGGGTGG + Intergenic
979969330 4:127114660-127114682 GGGCACACTGATGCAAGGGGTGG - Intergenic
980065813 4:128187340-128187362 GGGTATGCTGGTGCAAGGGGTGG - Intronic
980083538 4:128368878-128368900 GGTCATGCTGATGCAAGAGGTGG + Intergenic
980084406 4:128376934-128376956 GGGCATGCTGATGCAAGGGTGGG + Intergenic
980242158 4:130191089-130191111 GGTCATGCTCATGCAAGAGGTGG + Intergenic
980293149 4:130870942-130870964 GGTCATGCTGATGCAAAGGGTGG - Intergenic
980335619 4:131469324-131469346 GGTCACGCTAATGCAAGAGGTGG - Intergenic
980350768 4:131680807-131680829 GGTCATGCTTATGCAAGAGGTGG - Intergenic
980352365 4:131699319-131699341 GGTCATGCTAATGCAAGAGGTGG + Intergenic
980495031 4:133578698-133578720 GGTCATGCTGATGCAAGAGGTGG - Intergenic
980579675 4:134732945-134732967 GATCATGCTAATGCAAGAGGTGG - Intergenic
980596591 4:134962720-134962742 GGTCATGCTGATGCAAGAGGTGG - Intergenic
980707558 4:136519712-136519734 GGGCATGCTGATGCAAGAGGTGG + Intergenic
980757943 4:137190452-137190474 GGGCATGCTGATGCAGGGGTGGG + Intergenic
980850345 4:138373934-138373956 GGCCATGGTGATGCAAGAGGTGG + Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
981281611 4:142965882-142965904 GGTCATGCTGATGCAAGAGGTGG + Intergenic
981695300 4:147553320-147553342 GGCCATGCTGATGCAAGAGGTGG - Intergenic
981861556 4:149362004-149362026 GGTCATGGTGATGCAAGAGGTGG - Intergenic
981872979 4:149508429-149508451 GGTCATGCTGATGCAAGAGGTGG - Intergenic
982019724 4:151191006-151191028 GGTCATGCTGATGCAAGAGGTGG - Intronic
982121186 4:152145262-152145284 GGTCATGCTGATGCAAGAGGTGG + Intergenic
982389474 4:154848770-154848792 AGGCATGCTGATGCAAGAGGTGG - Intergenic
982477162 4:155867955-155867977 GGTCATGCTGATGCAAGAGGTGG + Intronic
982901529 4:161010098-161010120 GGGCAGTTGAATGCTAGGGGTGG + Intergenic
983068067 4:163235391-163235413 GGTCATGCTGATGCAAGAGGTGG + Intergenic
983075118 4:163316697-163316719 GGGCATATTGATGCAAAGAGGGG + Intergenic
983132787 4:164042957-164042979 GGGCATGCTAATGCAAGGAGGGG + Intronic
983320697 4:166192197-166192219 GGTCATGCTGATGCAAGAGGTGG - Intergenic
983351540 4:166596892-166596914 GGGCACATTGGTGCAAGGGGTGG - Intergenic
984056954 4:174942076-174942098 GGGCATGCTGATGTGAGGGGTGG + Intronic
984234787 4:177142628-177142650 AGTCATGTTGATGCAAGAGGTGG - Intergenic
985076841 4:186224447-186224469 GGGCATGCTGATGCAAGGTGTGG - Intronic
985094948 4:186403932-186403954 GGTCATGCTGATGCAAGAGGTGG + Intergenic
985135169 4:186778836-186778858 GGTCATGCTGATGCAAGAGGTGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985368534 4:189260432-189260454 GGGCATGCTGATGCAAGGGGTGG + Intergenic
985474184 5:68921-68943 GGGCATGCTGATGCAAGAGGTGG - Intergenic
986081056 5:4394739-4394761 GGTCATGCTGATGCAAGAGGTGG + Intergenic
986084798 5:4433676-4433698 GGTCATGCTGATGCAAGAGGTGG + Intergenic
986129010 5:4910072-4910094 GGTCATGCTGATGCAAGAGGTGG + Intergenic
986205807 5:5623913-5623935 GGACATGCTAGTCCAAGGGGTGG - Intergenic
986601612 5:9478517-9478539 GGGCACACTGATGCAAGGGGTGG - Intronic
986677548 5:10200241-10200263 GGGCATATTAATGCAAGGTAGGG - Intergenic
986873368 5:12078269-12078291 GGTCATGCTGATGCAAGAGGTGG + Intergenic
986960274 5:13202592-13202614 GGTCATGCTGATGCAAGAGGTGG + Intergenic
986975458 5:13388352-13388374 GGACATGCTGATGCAAGGGGTGG - Intergenic
986983507 5:13475311-13475333 GGTCATGCTGATGCAAGAGGTGG - Intergenic
987201665 5:15583644-15583666 GGGCATGCTTATGCAAGGGGTGG + Intronic
987226021 5:15842206-15842228 GGTCATGCTGATGCAAGAGGTGG - Intronic
987265942 5:16255356-16255378 GGGCATGCTGATGCAAGAGGTGG - Intergenic
987433615 5:17865751-17865773 GGCCATGCTGATGCAAGAGGTGG - Intergenic
987460097 5:18198517-18198539 GGGCACATTGGTGCAAGGGGTGG - Intergenic
987478970 5:18428828-18428850 GGTCATGCTGATGCAAGAGGTGG - Intergenic
987512418 5:18856837-18856859 GGTCATGCTGATGCAAGGGGTGG - Intergenic
987610735 5:20199301-20199323 GGTCACGTTGATGCAAGAGGTGG - Intronic
987612392 5:20223195-20223217 GGTCATGCTGATGCAAGAGGTGG - Intronic
987659624 5:20855346-20855368 GGTCATGCTCATGCAAGAGGTGG - Intergenic
987744148 5:21948334-21948356 GGGCATGTTAATGCAAGGGGTGG - Intronic
988028150 5:25726982-25727004 GGTCATGCTGATGCAAGAGGGGG + Intergenic
988134931 5:27158425-27158447 GGGCATGCTGATACAAGTGGTGG - Intergenic
988150024 5:27365047-27365069 GGTCATGCTGATGCAAGAGGTGG - Intergenic
988159599 5:27502681-27502703 GGGAATGTTGATGCAAGAAGTGG + Intergenic
988221176 5:28348870-28348892 GGTCATGCTGATGCAAGAGGTGG + Intergenic
988319188 5:29670276-29670298 GGGCATGCTGATGTAAGAGGTGG - Intergenic
988396058 5:30698997-30699019 GGGCATGCTGATGCAAGAGGTGG - Intergenic
988473818 5:31565323-31565345 GGTCATGCTGATGCAAGAGGTGG + Intergenic
988628261 5:32900576-32900598 GGTCATGCTGATGCAAGAGGTGG + Intergenic
988764020 5:34350301-34350323 GGTCATGCTCATGCAAGAGGTGG + Intergenic
988858490 5:35252589-35252611 GGTCATGCTGATGCAAGAGGTGG + Intergenic
988925167 5:35982387-35982409 GGACATGCTGATGCAAGGGGTGG - Intronic
989032750 5:37136354-37136376 GGTCATGCTGATGCAAGAGGTGG + Intronic
989133984 5:38135212-38135234 GGGAATCTTAATGCAAGCAGAGG - Intergenic
989399346 5:40992613-40992635 GGGCATGCTGATGCAAGAGGTGG + Intergenic
989515630 5:42339565-42339587 GAGCATGCTGATGCAAGAGGTGG + Intergenic
989520217 5:42392587-42392609 GGGCACACTAATGAAAGGGGTGG + Intergenic
989656706 5:43753070-43753092 GGTCATGCTGATGCAAGAGGTGG + Intergenic
989787008 5:45344694-45344716 GGGCATGCTGATGCAAGAGGTGG + Intronic
990329654 5:54713233-54713255 GGTCATGCTCATGCAAGTGGTGG - Intergenic
990484319 5:56243007-56243029 GGTCATGCTGATGCAAGAGGTGG - Intergenic
990501568 5:56401666-56401688 GGGCATATTTTTGGAAGGGGAGG - Intergenic
990789054 5:59455792-59455814 GGTCATGTTAACGCAAAGGGTGG - Intronic
990941397 5:61206253-61206275 GGTCATGCTGATGCAAGAGGTGG + Intergenic
991104859 5:62832580-62832602 GGTCATGCTGATGCAAGAGGTGG + Intergenic
991222990 5:64237241-64237263 GGGCATGCTGATGCAATGAGTGG - Intronic
991259422 5:64650819-64650841 GGGCATACTAGTGCAAGGGATGG - Intergenic
991516081 5:67437267-67437289 GGTCATGCTGATGCAAGAGGTGG - Intergenic
991535983 5:67669663-67669685 GGTCATGCTGATGCAAAGGGTGG - Intergenic
991764352 5:69958471-69958493 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991782976 5:70159676-70159698 GGGCATGTTAATGCAAGGGGTGG + Intergenic
991843584 5:70833543-70833565 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991875417 5:71160003-71160025 GGGCATGTTAATGCAAGAGGTGG + Intergenic
992591599 5:78301325-78301347 GGACATGCTGATGCAAGGGGTGG - Intergenic
992969559 5:82042794-82042816 GGGCATGCTGATGCAAGGGGTGG + Intronic
993067001 5:83113287-83113309 GGTGATGCTAATGCAAGAGGCGG + Intronic
993253082 5:85553348-85553370 GGGCATGCTGATGCAAGGAGTGG + Intergenic
993256767 5:85601502-85601524 GGGGATGTTGATGATAGGGGAGG + Intergenic
993263675 5:85694296-85694318 GGGCATGCCAATTCAAAGGGTGG + Intergenic
993390916 5:87319090-87319112 GGGCACGCTGATGCAAGGGGTGG + Intronic
993413140 5:87596266-87596288 GGGTATGCTGATGCAAGAGGTGG + Intergenic
993456250 5:88130858-88130880 GGGCACAGTGATGCAAGGGGTGG + Intergenic
993590558 5:89790329-89790351 GGTTATGTTGATGCAAGAGGTGG + Intergenic
993761242 5:91799944-91799966 GGTCATGCTAATGCAAGAGGTGG + Intergenic
993792489 5:92224234-92224256 GGTCATGCTGATGCAAGAGGTGG + Intergenic
993801850 5:92351933-92351955 GGTCATGCTGATGCAAGAGGTGG - Intergenic
994325623 5:98442087-98442109 GGTCATATTGATGCAAGAGGTGG + Intergenic
994549208 5:101209008-101209030 GGGCACACTAGTGCAAGGGGTGG - Intergenic
994580227 5:101632379-101632401 GAGCATGCTGATGCAAGGAGTGG + Intergenic
994621852 5:102172885-102172907 GGTCATGCTGATGCAAGAGGTGG - Intergenic
994649140 5:102504693-102504715 GGTCATGCTGATGCAAGAGGTGG - Intergenic
994808316 5:104479746-104479768 GGGCATGCTGATGCAAGAGGTGG - Intergenic
994920024 5:106031716-106031738 GGTCATGCTGATGCAAGAGGTGG + Intergenic
994970516 5:106730985-106731007 GGGCATGTTACTGACAGGGGTGG - Intergenic
995113581 5:108454312-108454334 GGTCATGCTGATGCAAGAGGTGG - Intergenic
995212122 5:109551984-109552006 GATCATGTTAATGCAAGAGGTGG - Intergenic
995283250 5:110358316-110358338 GGTCATGCTGATGCAAGAGGTGG - Intronic
995392348 5:111653101-111653123 GGTCATGCTGATGCAAGAGGTGG + Intergenic
995828565 5:116329131-116329153 GGTCATGCTGATGCAAGAGGTGG + Intronic
996011179 5:118483303-118483325 GGTTATATTGATGCAAGGGGTGG + Intergenic
996046696 5:118882259-118882281 GGGCAAGTTGATGCAACAGGAGG + Intronic
996087859 5:119322524-119322546 TGGCATTTTAATGCTAGGTGGGG + Intronic
996098175 5:119420944-119420966 GGTCATGGTGATGCAAGAGGTGG - Intergenic
996122839 5:119691100-119691122 GGGCACGCTGATGCAAGAGGTGG + Intergenic
996179357 5:120399977-120399999 GGTCATGCTGATGCAAGAGGTGG - Intergenic
996255941 5:121403040-121403062 GGTCATGCTGATGCAAGAGGTGG - Intergenic
996356349 5:122600187-122600209 GGGAATGATGATGCAAGGGGTGG + Intergenic
996600109 5:125253269-125253291 GGTCATGCTGATGCAAGAGGTGG + Intergenic
996605176 5:125313235-125313257 GGGCATGCTGATGCAAGGGATGG + Intergenic
996834644 5:127777219-127777241 GGTCATGCTAATGAAAGAGGTGG - Intergenic
996907916 5:128622667-128622689 GGGCATGTTAATGAAAGAAAGGG + Intronic
999012357 5:148056539-148056561 GGTCATGCTGATGCAAGAGGTGG - Intronic
999108070 5:149091368-149091390 GGTCATGCTGATGCAAGAGGTGG - Intergenic
999504354 5:152179793-152179815 GGGCATGCCGATGCAAGGGGTGG + Intergenic
999541149 5:152573515-152573537 GGTCAGGTTGATGCAAGAGGTGG - Intergenic
999804825 5:155071777-155071799 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1000270433 5:159678761-159678783 GGACATACTGATGCAAGGGGTGG + Intergenic
1000515936 5:162236528-162236550 GGTCATGCTAATGCAAGAAGTGG + Intergenic
1000564824 5:162834597-162834619 GGTCATGCTGACGCAAGGGGTGG + Intergenic
1000575007 5:162966404-162966426 AGGCATGCTGATACAAGGGGTGG + Intergenic
1000575470 5:162970198-162970220 GGGCATGTTAATGCAAGGGATGG - Intergenic
1000581098 5:163035971-163035993 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1000674650 5:164105801-164105823 GGGCATGTTGATGCAAGGGATGG - Intergenic
1000947269 5:167437217-167437239 GGTCATGCTGATGCAAGAGGTGG - Intronic
1000979298 5:167799215-167799237 GGGTATGTAAATGCAGGGGAGGG + Intronic
1001684856 5:173585786-173585808 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1001934875 5:175696776-175696798 GGGGAAGTTAAGGCAAGGAGAGG - Intergenic
1001943902 5:175761604-175761626 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1002009252 5:176264066-176264088 GGGCATACTGGTGCAAGGGGTGG + Intronic
1002217469 5:177648217-177648239 GGGCATACTGGTGCAAGGGGTGG - Intergenic
1003226833 6:4213836-4213858 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1003228013 6:4223795-4223817 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1003229977 6:4243233-4243255 GGGCACACTGATGCAAGGGGTGG + Intergenic
1003767819 6:9261052-9261074 GGGCACGGTGATGCAAGAGGTGG + Intergenic
1004245695 6:13973073-13973095 GGTCATGCTGATGCAAGAGGTGG - Intronic
1004261613 6:14112775-14112797 GGGCATTTTAGGGCAAAGGGTGG + Intergenic
1004335804 6:14763302-14763324 GGGCATGTGAATGCATGCTGAGG - Intergenic
1004471475 6:15933355-15933377 GGGGATGTTAATAATAGGGGAGG - Intergenic
1005417171 6:25612361-25612383 GGGCATGCTAGTCCAAAGGGAGG - Intronic
1005597687 6:27394807-27394829 GGGCACAATGATGCAAGGGGTGG - Intronic
1006693318 6:35909223-35909245 GGGCATGCCGATGCAAGGGGTGG - Intronic
1008631393 6:53365863-53365885 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1009309702 6:62134712-62134734 GGTCATGCTGATGCAAGAGGTGG - Intronic
1009550828 6:65089358-65089380 GGTCATGCTGATGCAAGAGGTGG - Intronic
1009607732 6:65895971-65895993 AGGCATGCTGATACAAGGGGTGG + Intergenic
1009669546 6:66729536-66729558 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1009732233 6:67622756-67622778 GGTCATATTGATGCAAGGGATGG - Intergenic
1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG + Intergenic
1009769086 6:68121692-68121714 GGTCATGCTGATGCAAGTGGTGG + Intergenic
1009824383 6:68847009-68847031 GGTCATGCTGATGCAAGAGGTGG - Intronic
1010324033 6:74544551-74544573 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1010515007 6:76762052-76762074 GGTCATGTTGATGCAAGAGGTGG + Intergenic
1010525292 6:76894001-76894023 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1010539091 6:77069344-77069366 GGGCATGCTGATGCAAGGGTTGG + Intergenic
1010551097 6:77223015-77223037 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1010555629 6:77275399-77275421 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1010611089 6:77954258-77954280 GGCCATGCTGATGCAAGGAGTGG - Intergenic
1010643045 6:78354230-78354252 GGCCACACTAATGCAAGGGGTGG + Intergenic
1010810352 6:80292947-80292969 GGTCAGGCTAATGCAAGAGGTGG + Intronic
1010906888 6:81501768-81501790 GGACATGCTGATGCAAGAGGTGG - Intronic
1010981655 6:82376266-82376288 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1011031802 6:82931537-82931559 GGTCATGCTGATGCAAGAGGTGG - Intronic
1011041223 6:83032285-83032307 GGTCATGCTGATGCAAGAGGTGG - Intronic
1011129831 6:84041601-84041623 GGTCATGCTTATGCAAGAGGTGG - Intronic
1011169399 6:84489300-84489322 GGGCATGCTAATGCAAGAGGTGG + Intergenic
1011263999 6:85496955-85496977 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1011288000 6:85745199-85745221 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1011294027 6:85807919-85807941 GGGCACACTGATGCAAGGGGTGG + Intergenic
1011382790 6:86760421-86760443 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1011461891 6:87613788-87613810 GGTCATGCTGATGCAAGAGGTGG + Intronic
1011876337 6:91966387-91966409 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1011876731 6:91971425-91971447 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1011933111 6:92738359-92738381 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1012005482 6:93708089-93708111 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1012098032 6:94991371-94991393 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1012185692 6:96213126-96213148 GGCCATGTCACTACAAGGGGTGG + Exonic
1012342325 6:98142768-98142790 GGGCATGGTGATGCAAGAAGTGG + Intergenic
1012349388 6:98232412-98232434 GGGAATGTTGATGCATGGGGTGG + Intergenic
1012485953 6:99722747-99722769 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1012617316 6:101293074-101293096 GGGCACACTAATGCAAGGGGTGG + Intergenic
1012664050 6:101943571-101943593 GGGTATGCTGATGCAAGAGGTGG - Intronic
1012732346 6:102899166-102899188 AGGCATGCTGATGCAAGAGGTGG + Intergenic
1012751453 6:103168466-103168488 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1012755814 6:103228476-103228498 GGTCATGTGAATGCAAGAGGTGG - Intergenic
1012811604 6:103966590-103966612 GGCCATGCTGATACAAGGGGTGG + Intergenic
1012823935 6:104124068-104124090 GGACATACTGATGCAAGGGGTGG - Intergenic
1013077086 6:106781102-106781124 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1013213613 6:108008012-108008034 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1013404670 6:109832084-109832106 GGTCATGCTGATTCAAGGGGTGG - Intergenic
1013890468 6:115020830-115020852 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1013918222 6:115367149-115367171 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1014043020 6:116851138-116851160 GGGCATGTTGATGCAAGGGTTGG - Intergenic
1014068075 6:117150373-117150395 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1014143549 6:117971277-117971299 GGTCATGCTGATGCAAGAGGTGG + Intronic
1014449438 6:121565884-121565906 GGTCATGCTGATGCAAGGGGTGG - Intergenic
1014649441 6:124017701-124017723 GGTCATGCTGATGCAAGAGGTGG + Intronic
1014665411 6:124231085-124231107 GGTCATGCTGATGCAAGAGGTGG - Intronic
1014771022 6:125458261-125458283 GGTCATGCTGATGCAAGTGGTGG + Intergenic
1014863177 6:126496277-126496299 GGTCATGCTGATGCAAGTGGTGG + Intergenic
1014875648 6:126655445-126655467 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1014895272 6:126893174-126893196 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1015045125 6:128767837-128767859 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1015054161 6:128879136-128879158 GGGCATGTTGATAAAGGGGGAGG + Intergenic
1015523249 6:134152017-134152039 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1015901812 6:138075412-138075434 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1016075876 6:139794984-139795006 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1016106537 6:140170913-140170935 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1016151569 6:140747836-140747858 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1016176379 6:141081765-141081787 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1016177647 6:141099591-141099613 GGTCATGATGATGCAAGAGGTGG - Intergenic
1016264265 6:142213300-142213322 GGTCATGCCAATGCAAGGGGTGG + Intronic
1016291728 6:142535010-142535032 GGGCACACTGATGCAAGGGGTGG - Intergenic
1016419950 6:143873258-143873280 GGTCATGCTGATGCAAGAGGTGG + Intronic
1016513015 6:144864352-144864374 GGGCACACTGATGCAAGGGGTGG - Intergenic
1016592934 6:145766247-145766269 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1016613804 6:146024413-146024435 GGGAATGCTGATGCAAGGGGTGG - Intergenic
1016632616 6:146249902-146249924 GGACACACTAATGCAAGGGGTGG - Intronic
1016785956 6:148010980-148011002 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1017860487 6:158393192-158393214 GGGCATGCTGATGCAAGAGGTGG + Intronic
1018075279 6:160207070-160207092 GGTCATGCTGATACAAGGGGTGG + Intronic
1018358314 6:163040614-163040636 GGGCATGCTGATGAAAGAGGTGG - Intronic
1018514362 6:164562385-164562407 GGACATGCTGATGCAAGTGGTGG - Intergenic
1018527529 6:164729284-164729306 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1018534607 6:164807066-164807088 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1018553537 6:165026393-165026415 GGGCATGTTCATGCAAAGAATGG + Intergenic
1018585245 6:165350247-165350269 GGTCATGCTGATGCAAGAGGTGG - Intronic
1018592594 6:165443378-165443400 GTGCATGCTGATGCAAGGGGTGG + Intronic
1018655172 6:166027337-166027359 GGGCATGGCAGAGCAAGGGGTGG - Intergenic
1018721643 6:166577458-166577480 GGTCATGCTGATGCAAGAGGTGG - Intronic
1019039419 6:169091190-169091212 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1019363423 7:617727-617749 GGGCCTGTGAACCCAAGGGGTGG + Intronic
1020537804 7:9423942-9423964 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1020579093 7:9971685-9971707 GGGCACATTGATGAAAGGGGTGG - Intergenic
1020780968 7:12516683-12516705 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1020869369 7:13608022-13608044 AGTCATGCTAATGCAAGAGGTGG - Intergenic
1021096394 7:16540183-16540205 GGGCATGCTGATGCAAAGGGTGG - Intronic
1021445415 7:20728444-20728466 GGGCATGTTCATGTAAGTCGTGG + Exonic
1021569249 7:22047958-22047980 GGGCATGTGTTTGCGAGGGGTGG + Intergenic
1021617763 7:22520314-22520336 GGGCACGCTGATGCAAGAGGTGG - Intronic
1021882934 7:25111513-25111535 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1022492823 7:30833905-30833927 GGTCATGCTGATGCAAGAGGTGG + Intronic
1022705937 7:32802157-32802179 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1022852698 7:34281897-34281919 GGACATGCTGATGCAAAGGGTGG + Intergenic
1022927352 7:35069790-35069812 GGGCACGCTAATGCAAGGGGTGG - Intergenic
1023208481 7:37776666-37776688 GGTCATGCTGATGCAAGAGGTGG - Intronic
1023236924 7:38099504-38099526 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1023406955 7:39843467-39843489 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1024021371 7:45373834-45373856 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1024207625 7:47177330-47177352 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1024384824 7:48739090-48739112 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1024487241 7:49932369-49932391 GGTCATGCTGATGCAAGAGGTGG - Intronic
1024671629 7:51600858-51600880 GGGCATGTGAATGGAGGTGGAGG - Intergenic
1024684866 7:51734266-51734288 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1024792838 7:52985864-52985886 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1025163076 7:56683001-56683023 GGCCATGCTGATGCAAGGGGTGG + Intergenic
1025221566 7:57114833-57114855 GGCCATGCTGATGCAATGGGTGG + Intergenic
1025632349 7:63286501-63286523 GGCCATGCTGATGCAATGGGTGG + Intergenic
1025650213 7:63459731-63459753 GGCCATGCTGATGCAATGGGTGG - Intergenic
1025721621 7:64020825-64020847 GGCCATGCTGATGCAAGGGGTGG - Intergenic
1025743645 7:64223623-64223645 GGGCATGCTGATGCAAGGGGTGG - Intronic
1025748776 7:64272053-64272075 GGCCATGCTGATTCAAGGGGTGG - Intergenic
1026278736 7:68903114-68903136 GGTCATGCAAATGCAAGAGGTGG - Intergenic
1027279192 7:76593390-76593412 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1027834222 7:83219630-83219652 GGACATGGTGATGCAAGAGGTGG - Intergenic
1028032481 7:85933287-85933309 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1028066500 7:86391489-86391511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1028143678 7:87298589-87298611 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1028173403 7:87627524-87627546 GGGCATATTGGTGCAAAGGGAGG + Intronic
1028189228 7:87825750-87825772 GGTCATGCTGATGCAAGGGATGG - Intronic
1028220624 7:88192089-88192111 GGGAATGTTAGTGGGAGGGGCGG - Intronic
1028374916 7:90135794-90135816 GGGCATGCTGATGCAAGGCGTGG + Intergenic
1028404938 7:90464736-90464758 GGTCATGCTGATGCAAGAGGTGG - Intronic
1028844213 7:95461319-95461341 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1029812116 7:103059802-103059824 GAGCAAGATAATGCAAAGGGTGG + Intronic
1030144621 7:106340938-106340960 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1030357256 7:108556586-108556608 AGGCATGCTGATGCAAGGGGTGG + Intronic
1030381239 7:108813860-108813882 GGTCATACTGATGCAAGGGGTGG - Intergenic
1030754623 7:113272788-113272810 GGGCACACTGATGCAAGGGGTGG + Intergenic
1030784699 7:113645362-113645384 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1030826883 7:114169336-114169358 GGTCATGCTGATGCAAGAGGTGG - Intronic
1031035635 7:116785108-116785130 GGGCACGCTGATGCAAGGGATGG + Intronic
1031238733 7:119211271-119211293 GGACATGCTGATGCAAGAGGTGG - Intergenic
1031283981 7:119841559-119841581 GGGCACACTGATGCAAGGGGTGG - Intergenic
1031315949 7:120257488-120257510 GGGCATGATGATGCAAGGGGTGG - Intergenic
1031435558 7:121728328-121728350 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1031576085 7:123417492-123417514 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1031645639 7:124221953-124221975 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1031677970 7:124634438-124634460 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1031690199 7:124778395-124778417 GGGCATGTTTCTGCATGTGGGGG + Intronic
1031725251 7:125230127-125230149 GGGCATGCCGATGCAAGGAGTGG + Intergenic
1031806758 7:126316722-126316744 GGGAATTCTGATGCAAGGGGTGG + Intergenic
1031807673 7:126327617-126327639 GGGCATGCTACTGCAAGCGATGG - Intergenic
1031818833 7:126473302-126473324 GGTCATGCTGATGCAAGAGGTGG - Intronic
1033119827 7:138657861-138657883 GGTCCTGTGAATTCAAGGGGAGG + Intronic
1033225055 7:139554698-139554720 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1033419654 7:141194498-141194520 GGTCATGTTGATGCTAGAGGTGG + Intronic
1033482974 7:141760189-141760211 GGGCATGCTGATGCAAGAGGTGG + Intronic
1033716840 7:144011047-144011069 GGGCATGCTTATGCAACAGGTGG - Intergenic
1033721151 7:144060589-144060611 GGTCACATTGATGCAAGGGGTGG - Intergenic
1033894297 7:146052901-146052923 TGGCATGTTAAAGGAAGTGGTGG + Intergenic
1033910764 7:146260517-146260539 GAGCATGCTGATGCAAGGAGGGG - Intronic
1034011163 7:147531067-147531089 GGTCACGCTGATGCAAGGGGTGG + Intronic
1034209236 7:149348642-149348664 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1034689233 7:153000645-153000667 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1034710324 7:153185506-153185528 GGGCACATTGGTGCAAGGGGTGG + Intergenic
1034714540 7:153229161-153229183 GGGCCTGTTGGTGGAAGGGGAGG - Intergenic
1034728760 7:153365281-153365303 GGGCACATTGGTGCAAGGGGTGG + Intergenic
1034751376 7:153571899-153571921 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1034851974 7:154501972-154501994 GGTCATGTTGATGCAAGAGGTGG - Intronic
1035120684 7:156564216-156564238 GGGTATGCTGATGCAAGGGGTGG + Intergenic
1035307546 7:157942946-157942968 GGGCATGGAAATGCCAGGGATGG - Intronic
1035371265 7:158380485-158380507 GGTCATGGTGATGCAAGAGGTGG + Intronic
1035547978 8:498312-498334 GGGCATGCTGATGCAAGGGGTGG - Intronic
1035709850 8:1704976-1704998 GGGCCTTCTAATGAAAGGGGTGG - Exonic
1036461761 8:8959850-8959872 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1036918543 8:12829659-12829681 GGGGATGCCAATGCAAGGAGAGG - Intergenic
1037206073 8:16321210-16321232 GGACATGCTGATGCAAGAGGTGG - Intronic
1037243421 8:16804123-16804145 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1037590375 8:20306877-20306899 GGGTATGGTAATGCAATGGCTGG + Intergenic
1037660207 8:20919823-20919845 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1039107352 8:34003919-34003941 GGGCACATTGATGCAATGGGTGG + Intergenic
1039251562 8:35670708-35670730 GGGGATGTGAGGGCAAGGGGAGG + Intronic
1039642684 8:39241171-39241193 GGTCATGCTGATGCAAGAGGTGG + Intronic
1040078011 8:43259881-43259903 GGGCATGCTGATGCAAGGAGTGG + Intergenic
1040094961 8:43434144-43434166 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1040797248 8:51299793-51299815 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1041339142 8:56823257-56823279 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1041351332 8:56950770-56950792 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1041490560 8:58427878-58427900 GGGCATATTTATGTAAGAGGAGG + Intronic
1041491555 8:58438453-58438475 GGGCATATTGGTGCAAGAGGTGG - Intronic
1041494481 8:58470139-58470161 GGGCATATTGATGCAAGAGGTGG - Intergenic
1041852140 8:62403984-62404006 GGGCATGCTGTTGCAAGAGGTGG - Intronic
1041953982 8:63537059-63537081 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1042161908 8:65905108-65905130 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1042180995 8:66087766-66087788 GGGCATGTTGATGCAAGAGGTGG + Intronic
1042194463 8:66220734-66220756 GCCCATGTTAAGGAAAGGGGAGG + Intergenic
1042601375 8:70502780-70502802 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1042772882 8:72398538-72398560 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1042982062 8:74540751-74540773 GGGCACACTGATGCAAGGGGTGG + Intergenic
1043205003 8:77426686-77426708 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1043262485 8:78219858-78219880 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1043336202 8:79180006-79180028 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1043492430 8:80763002-80763024 GCGCATGCTGATGCAAGAGGTGG + Intronic
1043510578 8:80946440-80946462 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1043694819 8:83204926-83204948 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1043779381 8:84312667-84312689 GGGCATGCTGATGCAAAGGGTGG + Intronic
1043805837 8:84671188-84671210 GGTCATGCTGATGCAAGAGGTGG + Intronic
1043834646 8:85032893-85032915 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1044087135 8:87955478-87955500 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1044125242 8:88451874-88451896 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1044538168 8:93381354-93381376 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1044851503 8:96433004-96433026 GGGCATGATGATGCAAAGGGTGG - Intergenic
1045422101 8:102026520-102026542 GGTCATGCTGATGCAAGAGGTGG + Intronic
1045588107 8:103562481-103562503 GGTCATGCTGATGCAAGAGGTGG + Intronic
1045675932 8:104607956-104607978 GGTCATGCTGATGCAAGAGGTGG - Intronic
1045700686 8:104862855-104862877 GGGCATGCTGATGCAAGGGGTGG - Intronic
1045884357 8:107078505-107078527 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1045940005 8:107728165-107728187 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1046050198 8:109013044-109013066 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1046107483 8:109683314-109683336 GGTGATGTTGATGCAAGAGGTGG - Intronic
1046146886 8:110172175-110172197 GGTCATGTTGATGTAAGAGGTGG - Intergenic
1046232358 8:111374047-111374069 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1046264506 8:111813918-111813940 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1046352494 8:113033359-113033381 GGGCATATTGATGCAATGGGTGG - Intronic
1046358413 8:113117735-113117757 GGTCATGCTGATGCAAGAGGTGG - Intronic
1046433069 8:114153498-114153520 GGTCATGTTGATGCAAGAAGTGG + Intergenic
1046532995 8:115471879-115471901 GGTCATGCTGATGCAAGAGGTGG + Intronic
1046668797 8:117035445-117035467 GGGCATGCTGATGCAAGGCGTGG + Intronic
1046699719 8:117386465-117386487 GAGCATGTCACTGCAAGAGGGGG - Intergenic
1046839575 8:118841758-118841780 GAGCATGTTGATGCAAGGGCTGG - Intergenic
1047628124 8:126677610-126677632 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1047649086 8:126900393-126900415 TGGTATGCTGATGCAAGGGGTGG - Intergenic
1047923322 8:129657418-129657440 GGGCAGGTTGATGTAAGGAGTGG + Intergenic
1048043263 8:130750828-130750850 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1048120469 8:131575283-131575305 GGGCCTGTTAGGGCATGGGGTGG + Intergenic
1048217533 8:132510119-132510141 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1048537638 8:135312502-135312524 GGGCATGCTGATGCAAGCAGTGG + Intergenic
1048726101 8:137387070-137387092 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1048783037 8:138022247-138022269 GGTCATGCTAATGCAAAAGGTGG - Intergenic
1048895717 8:138990522-138990544 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1049076369 8:140399460-140399482 GGTCATGCTGATGCAAGAGGTGG - Intronic
1049449023 8:142648927-142648949 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1049589223 8:143448546-143448568 GGGCACAGTGATGCAAGGGGAGG + Intronic
1050402523 9:5271187-5271209 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1050508565 9:6371282-6371304 GGGCATGCTGATGCAAGAAGTGG - Intergenic
1050890491 9:10818932-10818954 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1050894706 9:10872386-10872408 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1050939403 9:11439984-11440006 GGGCACGCTGATGCAAGGGATGG - Intergenic
1050940576 9:11452268-11452290 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1050987467 9:12101769-12101791 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1051063211 9:13069497-13069519 GGGCATACTAAAGCAGGGGGTGG - Intergenic
1051767386 9:20540099-20540121 GGGCATGCTGATGCAAGGGCTGG + Intronic
1051841345 9:21401648-21401670 GGGCATGTTCAGCCAATGGGTGG + Intergenic
1051860763 9:21622807-21622829 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1051920756 9:22260663-22260685 GGGCATACTGATGCAAAGGGTGG - Intergenic
1052530938 9:29683050-29683072 GGGCATATTATTGCAAGAGGTGG - Intergenic
1052705343 9:31988256-31988278 GGCCATGCTGATGCAAGAGGTGG + Intergenic
1052767894 9:32660281-32660303 AGTCATGCTAATGCAAGAGGTGG + Intergenic
1052782493 9:32795667-32795689 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1053246091 9:36535795-36535817 GGTCATGTTGATGCAAGAGGTGG - Intergenic
1053780347 9:41600394-41600416 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1054151677 9:61610929-61610951 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1054168289 9:61810551-61810573 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1054669240 9:67770267-67770289 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1054797091 9:69312821-69312843 GGGCATGCTGATGCAAAGGTTGG + Intergenic
1055180424 9:73380170-73380192 GGGCACGTTCATGCAAGGAATGG + Intergenic
1055223889 9:73970408-73970430 GGGCATGCTGATGCAACAGGTGG - Intergenic
1055542036 9:77319821-77319843 GGGAATGTTAATAAAGGGGGAGG - Intronic
1055579236 9:77690722-77690744 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1055858761 9:80723818-80723840 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1056434906 9:86566348-86566370 GGGCATGCTGATGCAAGAAGTGG + Intergenic
1056595220 9:88002343-88002365 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1058101864 9:100925328-100925350 GAGCATGCTGATGCAAGAGGTGG - Intergenic
1058230397 9:102417611-102417633 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1058766887 9:108190440-108190462 GAGCATTTTAAAGCAAGAGGTGG + Intergenic
1059110691 9:111556217-111556239 GGGCATGCTGATGCAAAGGGTGG + Intronic
1060312021 9:122470766-122470788 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1060449449 9:123723081-123723103 GGTCATGCTGATGCAAGAGGTGG - Intronic
1062616819 9:137400904-137400926 GGTCATGCTGATGCAAGAGGTGG + Intronic
1186323934 X:8458648-8458670 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1186926159 X:14335516-14335538 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1186980716 X:14954918-14954940 TGGCATGCTGATGCAAGAGGTGG + Intergenic
1187002721 X:15199388-15199410 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1187070049 X:15879236-15879258 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1187407047 X:19013828-19013850 GGGCATGTCAATGGCAGGGCTGG + Exonic
1187603821 X:20861792-20861814 GGCCATGCTAATGCAAGGGGTGG - Intergenic
1187628658 X:21144010-21144032 CGGCATGCAGATGCAAGGGGTGG + Intergenic
1187639597 X:21273812-21273834 GGGCTCGCTGATGCAAGGGGTGG + Intergenic
1188114939 X:26231570-26231592 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1188115535 X:26238523-26238545 GGGCACGCTGATGCAAGGGGTGG + Intergenic
1188166440 X:26870152-26870174 GGGCACACTGATGCAAGGGGTGG + Intergenic
1188305657 X:28557825-28557847 GTACATGCTGATGCAAGGGGTGG + Intergenic
1188587894 X:31799947-31799969 GGTCATGCTGATGCAAGAGGTGG + Intronic
1188662284 X:32775133-32775155 GGGCAGGCTGATGCAAGGGGTGG + Intronic
1188925888 X:36043606-36043628 AGGCATGCTGATGCAAAGGGTGG + Intronic
1188957321 X:36448890-36448912 GGGCACATTGATGCAATGGGTGG + Intergenic
1189035060 X:37487391-37487413 GAGCATGCTGATGCAAGGAGTGG + Intronic
1189408210 X:40744735-40744757 GAGCACGCTCATGCAAGGGGTGG + Intergenic
1189431327 X:40950174-40950196 GGGCACACTGATGCAAGGGGTGG + Intergenic
1189553033 X:42113216-42113238 GGGCATACTGATGCAAGGGGTGG + Intergenic
1189604298 X:42660192-42660214 AGTCATGCTAATGCAAGAGGTGG - Intergenic
1189637131 X:43023253-43023275 GGTCACGCTCATGCAAGGGGTGG + Intergenic
1190387660 X:49898420-49898442 GGACATGCTGATGCAAGGGGGGG - Intergenic
1190514365 X:51207398-51207420 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191211397 X:57889042-57889064 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1191606841 X:63071785-63071807 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1191710930 X:64149451-64149473 GGGCATGCTGGTGGAAGGGGTGG + Intergenic
1191783952 X:64897457-64897479 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1191802197 X:65093529-65093551 GGGCATGCTGATGTAAGGGGTGG - Intergenic
1191873402 X:65769484-65769506 GGCCATCCTGATGCAAGGGGTGG - Intergenic
1192071041 X:67941498-67941520 GGGCATACTGGTGCAAGGGGTGG + Intergenic
1192378378 X:70587885-70587907 GGTCATGCTGATGCAAGAGGTGG - Intronic
1192697827 X:73437106-73437128 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1193027015 X:76855666-76855688 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1193050714 X:77096508-77096530 GGGTATGTTGATGCAAGGAGTGG - Intergenic
1193199031 X:78666107-78666129 GGGCACATTGATGCAAGAGGTGG - Intergenic
1193226512 X:78990088-78990110 GGTCATGGTGATGCAAGAGGTGG - Intergenic
1193246495 X:79236628-79236650 GGTCATGCTGATGCAAGAGGAGG + Intergenic
1193316472 X:80071489-80071511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1193329707 X:80222663-80222685 AGGCATGCTGATGCAAGGGGTGG - Intergenic
1193330158 X:80226840-80226862 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1193387246 X:80886132-80886154 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1193459668 X:81775534-81775556 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1193485167 X:82078469-82078491 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1193497434 X:82231975-82231997 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1193643429 X:84039551-84039573 GGGCACATTGATGCAAGGGGTGG + Intergenic
1193706182 X:84823244-84823266 TGGCATGCTGATACAAGGGGTGG + Intergenic
1193850551 X:86531930-86531952 GGGTATGCTGATGCAAGGGGTGG - Intronic
1193857781 X:86626289-86626311 GGTCATGCTGATGCAAGAGGTGG + Intronic
1193911212 X:87309187-87309209 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1193930063 X:87542466-87542488 GGGCATGCTGATGCAAGGTCTGG - Intronic
1193930610 X:87546768-87546790 GGGCACATTGATGCAAAGGGTGG - Intronic
1194034581 X:88854655-88854677 GGGCATAATGATGCAAGGAGTGG - Intergenic
1194053759 X:89104839-89104861 GGCCATGTTGATTCAAGGGGTGG + Intergenic
1194092795 X:89599792-89599814 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1194107725 X:89792573-89792595 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1194119175 X:89938961-89938983 GGGCACACTAGTGCAAGGGGTGG + Intergenic
1194149747 X:90309558-90309580 GGCCATGATGATGCAAGAGGTGG + Intergenic
1194252900 X:91600246-91600268 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1194256978 X:91646507-91646529 GGTCATGCTAATGCAAGAAGTGG - Intergenic
1194365199 X:93006167-93006189 GGGCATGGTGATGCAAGAGGTGG + Intergenic
1194409778 X:93543605-93543627 GGGCACATCAATGCAAGGGGTGG + Intergenic
1194435133 X:93860344-93860366 GGGCATTCTGATGCAAGGGGTGG - Intergenic
1194438647 X:93901490-93901512 GGGCATGGTGATGAAAAGGGTGG - Intergenic
1194507139 X:94746296-94746318 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1194542334 X:95190041-95190063 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1194582889 X:95697911-95697933 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1194841661 X:98751832-98751854 GAGCATGCTGATGCAAAGGGTGG + Intergenic
1194855190 X:98919108-98919130 GGGCACATTCATGCAATGGGTGG - Intergenic
1194941567 X:100016677-100016699 GGTCATGCTGATGCAAGTGGTGG - Intergenic
1194952698 X:100145473-100145495 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1195196143 X:102499489-102499511 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1195243159 X:102972954-102972976 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195823619 X:108973117-108973139 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1196223491 X:113139013-113139035 GGGCACACTGATGCAAGGGGTGG + Intergenic
1196285266 X:113871966-113871988 GGGCATGCTGATGCAAGAAGTGG - Intergenic
1196313437 X:114196242-114196264 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1196483685 X:116180209-116180231 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1196498616 X:116351238-116351260 GGGCATGCTGATGCAAAGGGTGG - Intergenic
1196543573 X:116937316-116937338 GGTCATATTGATGCAAGAGGTGG + Intergenic
1196547055 X:116974928-116974950 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1196565281 X:117197244-117197266 GGTCACGTTGATGCAAGAGGTGG - Intergenic
1196903467 X:120409581-120409603 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1197016500 X:121632258-121632280 GGTCATGCTAATGTAAGAGGTGG + Intergenic
1197040703 X:121932298-121932320 GGGCATGTTGATGCAAGAAGTGG + Intergenic
1197074693 X:122340713-122340735 GGGCACGTTGATGCAAGAGGTGG + Intergenic
1197088614 X:122509935-122509957 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1197092622 X:122556585-122556607 GGTCATGATGATGCAAGAGGTGG - Intergenic
1197387664 X:125821197-125821219 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1197439921 X:126475694-126475716 GGGCATACTGATGCAAGGGGTGG + Intergenic
1197441344 X:126494734-126494756 GGGCATGCTGATGCAAGAGATGG - Intergenic
1197526963 X:127575922-127575944 GGTCATGATGATGCAAGAGGTGG + Intergenic
1197578732 X:128255738-128255760 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1197581962 X:128294645-128294667 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1197583147 X:128310565-128310587 GGGAATGCTGATGCAAAGGGTGG + Intergenic
1197594321 X:128448788-128448810 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1197595043 X:128454554-128454576 TGCCATGCTGATGCAAGGGGTGG + Intergenic
1198304593 X:135368190-135368212 AAGCATGCTGATGCAAGGGGTGG + Intergenic
1198497097 X:137203862-137203884 GGGCACACTGATGCAAGGGGTGG + Intergenic
1198612576 X:138418286-138418308 GGGCATGCTGATGCAAGAGATGG - Intergenic
1198734680 X:139772601-139772623 GGTCATGCTGATGCAAGAGGTGG - Intronic
1198825730 X:140696193-140696215 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1198836035 X:140805765-140805787 GGGCATGTTGATGCAAGAGGTGG + Intergenic
1198990961 X:142514649-142514671 GGTCATGTTGATGCAAGAGGTGG + Intergenic
1199062524 X:143376046-143376068 AGGCATGCTAATGCAAAGGGTGG + Intergenic
1199070350 X:143468767-143468789 GGGCACGCTGATGCAAGAGGTGG + Intergenic
1199072700 X:143497682-143497704 GGGCAAGCTGATGCAAGAGGTGG + Intergenic
1199128645 X:144157435-144157457 GGGCACACTAGTGCAAGGGGTGG - Intergenic
1199170691 X:144731731-144731753 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1199193356 X:144997694-144997716 GATCATGTTGATGCAAGAGGTGG - Intergenic
1199289842 X:146093495-146093517 GGGCACGTTGCTGCAAGTGGTGG + Intergenic
1199400764 X:147395817-147395839 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1199515195 X:148668185-148668207 GGTCATGCTGATGCAAGAGGTGG + Intronic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1199908691 X:152261617-152261639 GGTCATGCTGATGCAAGAGGTGG + Intronic
1199928500 X:152494434-152494456 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1199931771 X:152530597-152530619 GGGCACGCCGATGCAAGGGGTGG + Intergenic
1200040122 X:153358916-153358938 GGTCATGCTGATGCAAGAGGTGG - Intronic
1200353818 X:155526744-155526766 GGGTATGCTGATTCAAGGGGTGG - Intronic
1200381641 X:155843270-155843292 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1200459682 Y:3440358-3440380 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1200472049 Y:3596520-3596542 GGGCACACTAGTGCAAGGGGTGG + Intergenic
1200496125 Y:3886293-3886315 GGCCATGATGATGCAAGAGGTGG + Intergenic
1200575697 Y:4885774-4885796 GGTCATGCTAATGCAAGAAGTGG - Intergenic
1200673426 Y:6122425-6122447 GGACATGGTGATGCAAGAGGTGG + Intergenic
1201797283 Y:17910967-17910989 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1201804270 Y:17995018-17995040 GGTCATGCTGATGCAAGAGGTGG + Intergenic
1201924917 Y:19273657-19273679 GGACATGCTGATGCAAGAGGTGG + Intergenic
1202358653 Y:24079992-24080014 GGTCATGCTGATGCAAGAGGTGG - Intergenic
1202512125 Y:25590121-25590143 GGTCATGCTGATGCAAGAGGTGG + Intergenic