ID: 987769798

View in Genome Browser
Species Human (GRCh38)
Location 5:22286972-22286994
Sequence CACTGTTTCCATAACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987769793_987769798 16 Left 987769793 5:22286933-22286955 CCTATATGCATCTTTAGACATTA 0: 1
1: 0
2: 0
3: 21
4: 262
Right 987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 124
987769792_987769798 17 Left 987769792 5:22286932-22286954 CCCTATATGCATCTTTAGACATT 0: 1
1: 0
2: 3
3: 19
4: 275
Right 987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987769798 Original CRISPR CACTGTTTCCATAACCAGGT GGG Intronic
900555205 1:3276845-3276867 CTCTCTTTCCATCACTAGGTTGG - Intronic
902159220 1:14516061-14516083 CACAGTTTCTAGAACCTGGTTGG - Intergenic
904290426 1:29481909-29481931 CACTGTGTCAATCACCAGCTGGG + Intergenic
905059445 1:35126923-35126945 CTCTGTCTCCAAAAACAGGTTGG - Intergenic
912103209 1:106237508-106237530 CACTATTTCCAGAACTAGATTGG - Intergenic
912681698 1:111733189-111733211 CACTATTTACATAAACAGATAGG - Intronic
917205296 1:172565203-172565225 CAGTGTCTCCACTACCAGGTAGG - Intronic
921979438 1:221239822-221239844 CACAGTTTCAATAACCATGATGG + Intergenic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1065245224 10:23749435-23749457 CAGAGTTTCTATCACCAGGTTGG + Intronic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1069323092 10:67198275-67198297 CACTATTTCCCTAAGCAAGTGGG + Intronic
1069348209 10:67495104-67495126 CACTTCTGCCATAGCCAGGTGGG - Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1071441505 10:85701642-85701664 AGCTCTTTCCATAAACAGGTGGG - Intronic
1073679178 10:105683377-105683399 CACTGTAGCCATAACTTGGTGGG - Intergenic
1073713702 10:106076526-106076548 ATCTGTTTCTAAAACCAGGTGGG + Intergenic
1074067628 10:110031493-110031515 CACTGGTTCTAGAACCAGGCTGG - Intronic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1078439858 11:11355604-11355626 CAGTGTTTCTAAAATCAGGTTGG - Intronic
1080774538 11:35373330-35373352 TGCTGTTTCCATAGCCAGGTTGG + Intronic
1087060576 11:93973151-93973173 CAATTTTTCCATAACTAGGGTGG - Intergenic
1087657348 11:100940478-100940500 CAATGTTTCCATGACCAAGGTGG - Intronic
1090594837 11:128310212-128310234 AACTGTTTCCATAAACAGCATGG - Intergenic
1096468549 12:51862385-51862407 ATCTGTTTTCATCACCAGGTAGG + Intergenic
1101765252 12:107692033-107692055 CACTCTGTCCCTAACAAGGTTGG - Intronic
1101905150 12:108819091-108819113 CATTATTTCCATAACCGGGGGGG + Intronic
1102572792 12:113837531-113837553 CACCGTTTCCCTAACGAGGTGGG + Intronic
1102611156 12:114113660-114113682 CAGTGTTCCCCTAACCAGGGGGG + Intergenic
1108439637 13:50437739-50437761 AACTGTTTCCATAGCCATGGTGG - Intronic
1111972628 13:94933045-94933067 AAGTGATTGCATAACCAGGTGGG - Intergenic
1115087220 14:29532115-29532137 CACTATGTCCATGACCAGATCGG - Intergenic
1121226595 14:92325651-92325673 CACTGTTTCCAGTCCCAGATGGG - Intronic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1127661875 15:61107094-61107116 AACTGTTTCCAAAAGCAGGGAGG + Intronic
1129970086 15:79770523-79770545 TGCTGTTTCCATAACCAGGATGG + Intergenic
1133262739 16:4561980-4562002 CCCTGTTTCCATAACATTGTGGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1141400353 16:83741960-83741982 CAATTTTTCCATGAACAGGTGGG - Intronic
1146328662 17:31909270-31909292 CAGGGTTTCCATGACCATGTTGG + Intergenic
1147473449 17:40686329-40686351 CACTGTTTCTCTCTCCAGGTAGG - Intergenic
1149164290 17:53731941-53731963 CACTCTTTCCATATTCTGGTCGG - Intergenic
1151618800 17:75232265-75232287 CGCTGTTTCCCTGTCCAGGTGGG + Intronic
1153666598 18:7372008-7372030 CACTGTGGCCATACCCTGGTGGG - Intergenic
1153996400 18:10445727-10445749 CACTTTTTCCATAAGAAGGGAGG - Intergenic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1155022922 18:21912889-21912911 CACTTTTTTCAGAACCAGCTTGG - Intergenic
1164498058 19:28787316-28787338 CATTCTTTCAATACCCAGGTTGG + Intergenic
1165279644 19:34785271-34785293 CACTGCTTCCATATCCATTTTGG + Intergenic
928730944 2:34231523-34231545 CACTGTTTCCATCAAGAGATGGG + Intergenic
929099425 2:38295579-38295601 CACTGTTTCAAGAACCAGATTGG - Exonic
929452292 2:42046229-42046251 CTCTGTTTACAAACCCAGGTTGG + Intergenic
929508294 2:42546075-42546097 CACTCTTTAGATAACCTGGTAGG + Intronic
929761849 2:44813737-44813759 CACTGTTGCTTTGACCAGGTTGG + Intergenic
930547151 2:52782796-52782818 CACTCTTTCCAGAATCAGTTTGG - Intergenic
930909256 2:56611026-56611048 CACTGGAGCCATAACCTGGTAGG - Intergenic
931843992 2:66183876-66183898 CCCTGTTTCCATACCCAGCCAGG - Intergenic
932684980 2:73861372-73861394 CACTGATTCCATCTACAGGTGGG + Intronic
935549468 2:104437174-104437196 CACTGTTTCCAAGACAGGGTAGG - Intergenic
941403857 2:165064455-165064477 CAATCTTTCCATAACCAGAACGG + Intergenic
942867616 2:180694878-180694900 GACTGTTTCTAAAACCATGTAGG + Intergenic
944392531 2:199231727-199231749 CCCTGTTACCAAAACCTGGTAGG - Intergenic
946128522 2:217585982-217586004 CTCAGTTTCCATAGCCAGATGGG + Intronic
947202850 2:227630321-227630343 CACTCTCTCCATAACCGGCTTGG + Intronic
947407917 2:229800079-229800101 CACTTTTTCCATAACCAAAATGG + Intronic
948629605 2:239293592-239293614 CCCTGTGTCCATAAGCAGGTGGG - Intronic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1176332067 21:5558418-5558440 CACTGTTTCCAGGCCCATGTGGG + Intergenic
1176395690 21:6262533-6262555 CACTGTTTCCAGGCCCATGTGGG - Intergenic
1176402116 21:6323197-6323219 CACTGTTTCCAGGCCCATGTGGG + Intergenic
1176435041 21:6665907-6665929 CACTGTTTCCAGGCCCATGTGGG - Intergenic
1176441467 21:6726571-6726593 CACTGTTTCCAGGCCCATGTGGG + Intergenic
1176459303 21:6992977-6992999 CACTGTTTCCAGGCCCATGTGGG - Intergenic
1176465729 21:7053640-7053662 CACTGTTTCCAGGCCCATGTGGG + Intronic
1176489290 21:7435418-7435440 CACTGTTTCCAGGCCCATGTGGG + Intergenic
1177323175 21:19547976-19547998 GACTGTTTACATATCCAGTTAGG - Intergenic
1177427268 21:20939626-20939648 CTCAGCCTCCATAACCAGGTGGG - Intergenic
1178097569 21:29232379-29232401 CACTGTCTCCCTAAGCAGGGAGG - Intronic
1181276961 22:21693532-21693554 CCCTGTGCCCAGAACCAGGTTGG - Intronic
1182327405 22:29524152-29524174 CACTGCTGTCATAGCCAGGTGGG - Intronic
1182482415 22:30617643-30617665 CCCTGTTTCCATAACACCGTGGG - Intronic
1183458281 22:37934461-37934483 CTCTGTCCCCAGAACCAGGTTGG + Intronic
1183683468 22:39348966-39348988 CACTGGTTCCAGGAGCAGGTTGG - Intergenic
949265933 3:2156205-2156227 CAGTGCTTCCATAACCAGCTGGG + Intronic
949333928 3:2952858-2952880 CGCTGTTGCTATAACCATGTTGG - Intronic
951671716 3:25190637-25190659 AACTGTTGCCATAAACAGATTGG - Intronic
951926420 3:27913415-27913437 CACTCCTTCCATAAAGAGGTGGG - Intergenic
954274205 3:49531903-49531925 CAAAGTTTCCATCACCAGATTGG + Exonic
956753189 3:72361228-72361250 GTCTGTTTCCACAACCAGTTGGG + Intergenic
959847491 3:111051228-111051250 TTCTGTTTCCATTACTAGGTAGG + Intergenic
960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG + Exonic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
963670559 3:148246933-148246955 CCATGTTTTCATAACAAGGTTGG - Intergenic
969299902 4:6291682-6291704 GACTGTGTCCATCACCAAGTGGG + Intronic
969375367 4:6760206-6760228 CCCTGTTTCCAACACCAGGTCGG + Intergenic
969594306 4:8140300-8140322 CTCTGTTTCCTTCACCAGATGGG - Intronic
970840142 4:20458844-20458866 TATTGTTTCTATAACCAAGTCGG - Intronic
971711660 4:30120534-30120556 CACTGATTCCACAAACAGGCTGG - Intergenic
972975722 4:44633162-44633184 CAATTTTTCCACAGCCAGGTTGG - Intronic
973027833 4:45294718-45294740 TTCTGTTTACAAAACCAGGTGGG + Intergenic
975019110 4:69465696-69465718 CACAGTTTCCAAACCCAGTTTGG - Intergenic
976604671 4:86971427-86971449 CACTTCTTCCATAACAAGGTGGG + Intronic
977875075 4:102140060-102140082 CACTTTTTATAAAACCAGGTAGG + Intergenic
984317555 4:178146062-178146084 CACTGCTTCTATAACCCTGTTGG - Intergenic
984444407 4:179817053-179817075 CACTGTTTTGATTACTAGGTCGG - Intergenic
985526499 5:405595-405617 CTCTGTATCCAGAACCAAGTGGG + Intronic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
985861706 5:2476639-2476661 CCCTCCTTCCATAACCAGGCTGG - Intergenic
987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG + Intronic
991593031 5:68274153-68274175 CACTGTTACCATAACAGGGCAGG - Intronic
996962239 5:129264837-129264859 CAGTTTTTCCATAGCCAGGATGG - Intergenic
1014319160 6:119905195-119905217 CACTGATTCCATAACCATATCGG - Intergenic
1017021874 6:150146584-150146606 CACAGTGTCCTTTACCAGGTGGG - Intronic
1017648616 6:156561813-156561835 CACGATTTCCATAACCAGAGTGG - Intergenic
1018447910 6:163874939-163874961 CACTGTTTGCATTAGCAGGAAGG - Intergenic
1022723619 7:32962020-32962042 CACTTTTTCCATGACCGGGGTGG - Intronic
1022828104 7:34037336-34037358 CACTGTCTCTATAGCCAGGCTGG + Intronic
1024434878 7:49340361-49340383 CTCTGTCTCCATAATCATGTGGG - Intergenic
1025707322 7:63879402-63879424 CACTGTTTACATAAACAAATTGG - Intergenic
1027483398 7:78728174-78728196 CACTGTTACCATAACCTCGCAGG - Intronic
1028625853 7:92875946-92875968 CACTGTTTCAACTCCCAGGTTGG - Intergenic
1030359596 7:108580615-108580637 CACTGTCTCCATGGCCAAGTGGG + Intergenic
1030979546 7:116170464-116170486 CAATCTTTACATAACAAGGTTGG + Intergenic
1031332861 7:120487606-120487628 CTCTGTCTCCCTACCCAGGTGGG + Intronic
1034347614 7:150397073-150397095 CGCTGCTTCCGTCACCAGGTGGG + Exonic
1044355236 8:91214674-91214696 CATTGATTCCATAAGCAGGGAGG + Intronic
1051785405 9:20737271-20737293 CACTGCTTTCATAAAAAGGTAGG + Intronic
1056083843 9:83125223-83125245 CACTGTTTCTGTAACCTGGCTGG - Intergenic
1056831218 9:89918881-89918903 CCCTCTTTCCATAACCAGCAGGG + Intergenic
1059334379 9:113559536-113559558 CACCGTTTCCATTAGCAGGTTGG + Intronic
1203430031 Un_GL000195v1:81914-81936 CACTGTTTCCAGGCCCATGTGGG - Intergenic
1203436495 Un_GL000195v1:142740-142762 CACTGTTTCCAGGCCCATGTGGG + Intergenic
1185742307 X:2543579-2543601 AGCAGTTTCTATAACCAGGTAGG - Intergenic
1186551189 X:10507331-10507353 CAGTGTTTCCATTACCTGGCAGG - Intronic
1190098825 X:47504590-47504612 CACTGTTTGCACAAACAGGTTGG - Intergenic
1200001077 X:153060075-153060097 CTCAGTTTCCTTAACCTGGTAGG + Intronic