ID: 987773482

View in Genome Browser
Species Human (GRCh38)
Location 5:22335864-22335886
Sequence GAGGCAAGCCACTTTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987773478_987773482 2 Left 987773478 5:22335839-22335861 CCACTGAAAGATACCTGAAAATG 0: 1
1: 0
2: 3
3: 34
4: 355
Right 987773482 5:22335864-22335886 GAGGCAAGCCACTTTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987773482 Original CRISPR GAGGCAAGCCACTTTGGAAC TGG Intronic
No off target data available for this crispr