ID: 987774691

View in Genome Browser
Species Human (GRCh38)
Location 5:22349076-22349098
Sequence CCTCATATGGTGAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987774691_987774697 2 Left 987774691 5:22349076-22349098 CCTTGTCCCTTCACCATATGAGG 0: 1
1: 0
2: 6
3: 23
4: 195
Right 987774697 5:22349101-22349123 ACCATGTGCAGGCACAGAGAAGG No data
987774691_987774699 24 Left 987774691 5:22349076-22349098 CCTTGTCCCTTCACCATATGAGG 0: 1
1: 0
2: 6
3: 23
4: 195
Right 987774699 5:22349123-22349145 GCATCACCTATAAGAAAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 172
987774691_987774696 -9 Left 987774691 5:22349076-22349098 CCTTGTCCCTTCACCATATGAGG 0: 1
1: 0
2: 6
3: 23
4: 195
Right 987774696 5:22349090-22349112 CATATGAGGTCACCATGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987774691 Original CRISPR CCTCATATGGTGAAGGGACA AGG (reversed) Intronic
902279683 1:15365190-15365212 CTTCTGATGGTGGAGGGACATGG - Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903177704 1:21590517-21590539 CCTCAGGTGGTGAAATGACAAGG + Intergenic
903811698 1:26038329-26038351 CCTGACATGGTGGAGGGAAAGGG - Exonic
905945395 1:41897452-41897474 CCTCAGATGGTGGAGGGGTAGGG - Intronic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
908454666 1:64291469-64291491 CCTCACATGGTGGAGAGAGAGGG + Intergenic
909039281 1:70630219-70630241 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
909481696 1:76133475-76133497 GGTCATATGGTGGAGAGACAGGG - Intronic
913184940 1:116362292-116362314 TCTCATATGGTGGTGAGACAGGG - Intergenic
913279492 1:117172300-117172322 CCTCATAAGGTGCAGCCACAAGG + Intronic
913348218 1:117829138-117829160 CCTTACATGGTGAAAGAACAAGG + Intergenic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
917231992 1:172847216-172847238 CCTCATTTGTTAAAGGGAGATGG - Intergenic
918414115 1:184289333-184289355 CCTTAGATGGTGAAGGCTCAGGG - Intergenic
922960202 1:229639704-229639726 CCTAATATGGTGGGGGGACAGGG - Intronic
924814050 1:247427154-247427176 CCTTACATGGTGAAGAGGCAAGG + Intronic
1063570661 10:7211867-7211889 CCTCATATGTTTAGGGGACCAGG - Intronic
1064427528 10:15243356-15243378 CCTTATACGGTCAAGGGACTTGG - Intronic
1069539014 10:69279269-69279291 CCTCATGTGGTGAAGGGCGTTGG + Intronic
1069900822 10:71705673-71705695 CCTCTATTGGTGAAGGGACGGGG + Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1071878617 10:89869939-89869961 CCTGGTATAGTGATGGGACATGG + Intergenic
1076782391 10:132731443-132731465 CCTGATATGGGGCAGGGACGCGG - Intronic
1078625422 11:12951511-12951533 CCTCATATGGTGAACAGAAAGGG - Intergenic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1085181791 11:74542639-74542661 CCTTAAATGGTGAAGGTTCAGGG - Intronic
1086943341 11:92820572-92820594 GCTCACATGGTGAGGGGTCAAGG + Intronic
1087897423 11:103602213-103602235 CCTGATTTGGTGAAGGGACATGG - Intergenic
1088546406 11:110963844-110963866 CTTCATCAGGTGAAGGGGCAGGG - Intergenic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1090882946 11:130850202-130850224 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1091540718 12:1458820-1458842 CCTTATCTGCTGAAGGGACCTGG + Intronic
1092144407 12:6204625-6204647 CCCCATCTGGTGATGAGACATGG - Intronic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1096814395 12:54192639-54192661 CCTGATTTGGGGAAGGGAAAAGG + Intergenic
1097329503 12:58318105-58318127 GCTCATAAGCTGAAGGGACTTGG - Intergenic
1097721015 12:63021544-63021566 CCTCAAATGGTAATGGGAAATGG + Intergenic
1098483820 12:70997413-70997435 ACACATCTGGAGAAGGGACAAGG + Intergenic
1099948163 12:89268909-89268931 CCTACTATGGTGAAGGAACTTGG + Intergenic
1101698477 12:107149450-107149472 GCTGAGATGGAGAAGGGACATGG - Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102147938 12:110668931-110668953 CCTGGTATGGGGCAGGGACATGG - Intronic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1102914304 12:116741524-116741546 CTTAATGTGGTGAAGGGAAAGGG + Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1109042214 13:57354050-57354072 CCTCATGTGGTTAAGAGGCAAGG - Intergenic
1109191537 13:59329704-59329726 CCTCAAGTGGTGCAGGGGCAAGG + Intergenic
1109241009 13:59888245-59888267 TCTGAGATGGTGGAGGGACAAGG - Intronic
1109274697 13:60290671-60290693 CCTCAGGTGGAGAAGGGACCTGG + Intergenic
1109752884 13:66719445-66719467 CCTCACATGGTGGAGGGCCCAGG - Intronic
1109778374 13:67074298-67074320 CCTCATCTGGGGAAGGGGCGAGG - Intronic
1111716016 13:91879557-91879579 CCTCAGTTGGGGAAGGAACAAGG + Intronic
1115001802 14:28430209-28430231 CATCTTGTGGTGATGGGACACGG - Intergenic
1115054856 14:29111142-29111164 TATCAAATGTTGAAGGGACAAGG - Intergenic
1115505078 14:34085998-34086020 CCTCATGTGGTAAAGGGTCAAGG + Intronic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1116073114 14:40074326-40074348 CTTCATATGCTGAGGGGACATGG - Intergenic
1117070266 14:52049817-52049839 CCACTTCTGGTGAAGGGAGAGGG + Intronic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1118430183 14:65710889-65710911 TGGCAGATGGTGAAGGGACATGG + Intronic
1118639154 14:67776298-67776320 CCTCATCTGGTGAAGGTACTTGG - Intronic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1120454009 14:84708446-84708468 CCACATGTGGGGAAGGGAGATGG - Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122751599 14:103937983-103938005 GCTCAGTTGGGGAAGGGACACGG + Intronic
1123002747 14:105304913-105304935 CCACATATTGTGGAGGGACCTGG - Exonic
1123852662 15:24376361-24376383 CCTCAGAAGATGAATGGACATGG + Intergenic
1123962120 15:25414404-25414426 CCTCATGTGGTGAAGGAAATGGG + Intronic
1127122683 15:55785258-55785280 CCTCTTCTGGTGGAGGGAGACGG - Intergenic
1132112103 15:99109161-99109183 CCTCATACAGTGAAGGCGCATGG - Intronic
1132362930 15:101233039-101233061 CCTCATCAGCTGAAGGGACCTGG - Intronic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1135568163 16:23528041-23528063 CCTCACGTGGTGGAGGGACGAGG - Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1138087436 16:54145587-54145609 CCTCACAGGGTGGAGGGTCAAGG - Intergenic
1138394403 16:56692780-56692802 CCACAAAGGGTTAAGGGACAAGG + Intronic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140239253 16:73186239-73186261 CCACAGATGGTGAGGGGGCATGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1146257926 17:31402326-31402348 CTCCATGTGGTGAAAGGACAGGG + Intronic
1148688393 17:49513256-49513278 CCTGAGATGGTGACGGGGCAGGG - Exonic
1151292830 17:73162899-73162921 CCTTTTAAGGTGAAGAGACAGGG - Intergenic
1152032390 17:77852582-77852604 CCTCAGCTGGTGAAGGACCAGGG - Intergenic
1153809690 18:8741055-8741077 CCCAGAATGGTGAAGGGACATGG + Intronic
1155374406 18:25139915-25139937 CCTTACTTGGTGAAGGGGCAAGG - Intronic
1157366163 18:47066031-47066053 CCTCCTATGGTGGAGGGAACTGG + Intronic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1158111182 18:53942797-53942819 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1159748617 18:72271756-72271778 CCTCATGTGGTGGACGAACAAGG + Intergenic
1159919631 18:74215815-74215837 ACTTATATGATGTAGGGACAAGG - Intergenic
1159991561 18:74914694-74914716 CCTCATGTGGGGAATGGACCCGG + Intronic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1164579209 19:29424203-29424225 CATCTTATGGTGATGGGAAAAGG + Intergenic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
925635182 2:5935652-5935674 TCTCATATGGGGATGGGGCAGGG - Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
931047067 2:58366415-58366437 CTTCATATGGTGGAGAGAGATGG - Intergenic
932467801 2:71934720-71934742 CGGCATATGGTGACGGGAAATGG + Intergenic
932718024 2:74116994-74117016 CCTCAAATGGGCAAGGGAGAGGG + Intergenic
933090206 2:78108757-78108779 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
935603058 2:104942133-104942155 CCTTATAGGCTGATGGGACAGGG + Intergenic
935653147 2:105399088-105399110 CCTTATATGGTCAAATGACACGG - Intronic
936659724 2:114529151-114529173 CATCATAGCTTGAAGGGACAAGG - Intronic
937069711 2:119053856-119053878 CCTCCTATTGGGAAGGAACATGG - Intergenic
938011579 2:127833001-127833023 CCTTAAATGGTGAAGGCCCAGGG - Intergenic
940699606 2:157024290-157024312 CCTCATAGGCAGAAGGGACTTGG + Intergenic
942211855 2:173678985-173679007 TCTCATATGGAAAATGGACATGG - Intergenic
943759085 2:191588940-191588962 CCTCACATGGAGAAAGGTCAAGG - Intergenic
948704608 2:239781106-239781128 CCTCAAATGGTCAAGGGGCAAGG + Intronic
948934411 2:241153312-241153334 CCTCAAATGGTGCTGGGACATGG + Intronic
1169606277 20:7323134-7323156 CCTCACATGGTGGAGGGTGAGGG + Intergenic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1170976256 20:21167406-21167428 GCTCAGATGGTGAAGGTATAAGG - Intronic
1172911952 20:38416130-38416152 CCTCATATGGTGGAGAGCGAGGG - Intergenic
1172993998 20:39056588-39056610 CCTCAGATGGTGAAATGTCAAGG - Intergenic
1178730063 21:35093663-35093685 CCCCAGATGGAGCAGGGACACGG - Intronic
1181570179 22:23764165-23764187 CCCCAGATGGTGAGGAGACAGGG + Exonic
1183119889 22:35722239-35722261 CCTCCTTTGGTAAAGGGAAAGGG + Intronic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
950670559 3:14522900-14522922 CTTCATCTGGGGAAGGGGCATGG + Intronic
951966959 3:28398211-28398233 CCTCACATGGTGAAGAGTCGAGG + Intronic
952343751 3:32466061-32466083 CCTCAAAGGGTGAAGGACCAAGG + Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952989431 3:38818813-38818835 CCTCAGATGGTGAAGGCATTTGG - Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954946021 3:54425008-54425030 CCTCAGCTAGTGAAGGAACATGG + Intronic
955122150 3:56071255-56071277 CCTCATATGCCATAGGGACATGG + Intronic
957241014 3:77661152-77661174 CAACATATGGTGGTGGGACAGGG - Intergenic
960960202 3:123065362-123065384 CCACAGATGGTGGGGGGACAGGG + Intergenic
961501853 3:127341980-127342002 CTTCCCATGGTGCAGGGACACGG - Intergenic
961541029 3:127599440-127599462 CCTCAAATGGTGGAAGGTCACGG - Exonic
961993184 3:131213990-131214012 CCTCATATGGTGGAGGAGCATGG - Intronic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
963901472 3:150737095-150737117 CGTGATATGGTGAAGGGGCATGG + Intergenic
964432760 3:156623436-156623458 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
965928211 3:174009142-174009164 CCTCACATGGTTAAGAGAGAAGG + Intronic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
974370358 4:61008989-61009011 CCTCACATGCTGAAGGGATGAGG + Intergenic
976397607 4:84572989-84573011 CCTCACATGGTGGAGAGAAAAGG - Intergenic
976542993 4:86299450-86299472 CCTCACCTGATGAAGGAACAAGG - Intronic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
978503421 4:109433421-109433443 CCTCAGTGGGTGAAGGGACCGGG - Intergenic
979772686 4:124548395-124548417 CCACAAATGGTGAAAGGAAAAGG - Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
980184465 4:129444875-129444897 CATCATTTGGAGAAGGTACAAGG + Intergenic
981150804 4:141377578-141377600 CATCATATTTTGAAGGGAAAGGG - Intergenic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
988990977 5:36670857-36670879 TCTCACAAGGTGAAGGGAAAAGG - Intronic
990976081 5:61563189-61563211 ACACATTTGGTGAAGGCACAAGG + Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
993146227 5:84096590-84096612 GCTCATAGGCTGAAGGGACTTGG + Intronic
993233787 5:85276049-85276071 CATCACATGGTGAAAAGACAAGG - Intergenic
993771481 5:91933300-91933322 CCTCCTATGGTGGAAGGGCAAGG + Intergenic
994516306 5:100776656-100776678 CCTCACATAGTGAAGAGAGAGGG - Intergenic
995624096 5:114057692-114057714 CTTCATATGGTGAGTGGACAGGG + Intergenic
995629207 5:114114961-114114983 ACTAATATTGTGAAGGGAAAAGG - Intergenic
996035009 5:118749178-118749200 CCTGACATGGTGAAGAGAGAGGG - Intergenic
998686745 5:144535661-144535683 CCTCACATCCTGCAGGGACATGG + Intergenic
999259545 5:150229433-150229455 CCTCCTAGAGTGAAGGGACTTGG + Intronic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
1000565526 5:162842021-162842043 CCTGATAGGGTGCAGGGAGAAGG + Intergenic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1005954820 6:30656459-30656481 TCTCATATGGTGGAGGGTCCAGG + Exonic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1008885009 6:56423271-56423293 TCTCTTATGAGGAAGGGACAAGG + Intergenic
1009651179 6:66479726-66479748 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1010153151 6:72759986-72760008 ACTAAAAGGGTGAAGGGACAAGG + Intronic
1010651500 6:78460614-78460636 CCTTTGATGGTGAAGAGACAGGG + Intergenic
1014573160 6:123036625-123036647 CCTGAAAAGGTGAAGGGAAAAGG - Intronic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015175723 6:130306003-130306025 CCTCACATGGTGGAAGGAAAAGG + Intronic
1015870562 6:137772415-137772437 CCATATATGGAGAAAGGACATGG - Intergenic
1015921350 6:138269245-138269267 CCTTAGAGGGTGAAGAGACAGGG - Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018417388 6:163612801-163612823 CCTAAAGTGGGGAAGGGACAGGG + Intergenic
1022474637 7:30701880-30701902 CCTCAGAGTGTGCAGGGACATGG + Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024894486 7:54242050-54242072 CCACATATTGTGAAGGAACCTGG + Intergenic
1026345008 7:69466152-69466174 ACTCATATGGTGAAGGCAGATGG - Intergenic
1028224059 7:88229284-88229306 CCTCATATGATGAAAGGACAAGG - Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1032492437 7:132333575-132333597 CCTCAGCTGCTGGAGGGACACGG + Intronic
1034003017 7:147437348-147437370 GCCCATATGGTTAAAGGACAGGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1040538509 8:48330523-48330545 CCTCAAAAGGTGCAGGGACCTGG - Intergenic
1045247607 8:100457262-100457284 CCTCATAAGATGAGGGGATAAGG + Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1048968202 8:139629069-139629091 CCTCATAATGAGAAGGGACTGGG - Intronic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1049459030 8:142713506-142713528 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1050171090 9:2817624-2817646 CCACATATAGTGAAAGGATAAGG + Intronic
1050208723 9:3228656-3228678 CCTCATATGTAGAAGGCATAGGG + Intronic
1050886743 9:10776413-10776435 CCTCATAAGCTGAAGTGCCAGGG - Intergenic
1053289846 9:36872759-36872781 CCTCATAGGGTGGGGGGACGAGG - Intronic
1055336469 9:75237470-75237492 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1055791637 9:79928891-79928913 CCACATTTGGTGAAGGGTAATGG - Intergenic
1056497742 9:87176821-87176843 GCTCATATGGTGAAGACAGAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057597614 9:96428666-96428688 CCTCAGTTAGTGAAGGAACAAGG + Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058778848 9:108312658-108312680 GCTCTTAAGGTGAAGTGACATGG + Intergenic
1058834828 9:108851770-108851792 CCTGGTCTGGAGAAGGGACAAGG + Intergenic
1185973352 X:4690092-4690114 AGTCCAATGGTGAAGGGACAAGG - Intergenic
1185997865 X:4973111-4973133 CCTCACACGGTGGAAGGACAAGG - Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188618656 X:32192167-32192189 CCTCATAGAGTGAAGGAACCAGG - Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1189543657 X:42019348-42019370 CATCATATGGGGAAGTCACAAGG - Intergenic
1190308410 X:49100058-49100080 AGTCACATGCTGAAGGGACAGGG - Intronic
1190309570 X:49107270-49107292 CCTCATATGTAAAATGGACATGG + Intergenic
1193396449 X:80989584-80989606 CCTCAGATTCTGAAGTGACAAGG - Intergenic
1193641418 X:84013722-84013744 ACTCTTAAGGAGAAGGGACATGG + Intergenic
1194686891 X:96930759-96930781 GCTCATAAGGAGAAGTGACAAGG - Exonic
1195121233 X:101755118-101755140 CCTCAGATGGTGCAGGGTCCAGG - Intergenic
1196095543 X:111794722-111794744 CCTCATATGGTGAAGCAAAAGGG + Intronic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1200024663 X:153247249-153247271 CTTCACATGGTGAAGGGCCTGGG - Intergenic
1200310791 X:155075250-155075272 TATCAGATGTTGAAGGGACAAGG - Intronic