ID: 987776786

View in Genome Browser
Species Human (GRCh38)
Location 5:22377000-22377022
Sequence AGGTCCCATGATGCCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987776786_987776790 5 Left 987776786 5:22377000-22377022 CCACCAGAGGCATCATGGGACCT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 987776790 5:22377028-22377050 AAGGCAACAAGCAGATCTCAAGG 0: 1
1: 0
2: 1
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987776786 Original CRISPR AGGTCCCATGATGCCTCTGG TGG (reversed) Intronic
901944174 1:12687678-12687700 AGGTCCCATGCTACCACTGGGGG + Intergenic
911610753 1:99957163-99957185 AGGTCCCATTTAGCCCCTGGGGG - Intergenic
912450696 1:109765827-109765849 AGGTGCTAGGATCCCTCTGGAGG + Intronic
913199043 1:116481602-116481624 TGTTCCCATGATGCCACTGCTGG - Intergenic
919989047 1:202696331-202696353 AAGACCCAGGATGCCTATGGTGG + Intronic
922045903 1:221946077-221946099 AGGTACCATGATGGCAATGGGGG - Intergenic
922706296 1:227792521-227792543 AGGACCTCTGAGGCCTCTGGAGG - Intergenic
1063435265 10:6024450-6024472 AGGGCCCACGATGTGTCTGGTGG + Intronic
1064370555 10:14748900-14748922 AGGCCACATGGTCCCTCTGGGGG - Intronic
1064421310 10:15193210-15193232 AGCTCCCATAATTCCTCAGGTGG + Intergenic
1069419980 10:68238585-68238607 AGTTCACATGAAGCATCTGGTGG - Intergenic
1069901151 10:71707332-71707354 AGGCCCCATGATTCCTAGGGAGG + Intronic
1071173968 10:82901580-82901602 AAGTCCCATTATTCTTCTGGAGG - Intronic
1074004989 10:109412627-109412649 AGGTCCCATGATTCAGATGGAGG + Intergenic
1080685450 11:34511578-34511600 AGGTCCCCAGATGCCTCCAGTGG + Exonic
1082319156 11:50776541-50776563 AAGCCCCTTGATGCCTATGGTGG - Intergenic
1083170743 11:60922732-60922754 GGGTCCCCTGAGGCCTGTGGGGG + Exonic
1084316243 11:68347505-68347527 AGGGCCCCTGTAGCCTCTGGAGG + Intronic
1084554225 11:69866147-69866169 AGGCCCCAAGGAGCCTCTGGTGG - Intergenic
1086339756 11:85836782-85836804 AGGTCACATTATGACTTTGGAGG - Intergenic
1087856346 11:103096187-103096209 AAATCCCATGCTGCCTCTTGAGG + Intergenic
1090912996 11:131137778-131137800 AGCTCCCCTGAAGGCTCTGGGGG - Intergenic
1092260205 12:6949333-6949355 CTGACCCATGTTGCCTCTGGGGG + Intronic
1093149633 12:15605684-15605706 AGGTCCCATGAAGGCCCTTGCGG - Intergenic
1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG + Intronic
1094837102 12:34327249-34327271 AGGTCCCATGCTGGGTCTGTGGG + Intergenic
1096587012 12:52629363-52629385 AGGGCCCTTGCTGCCTGTGGTGG - Intergenic
1099662032 12:85576374-85576396 ATGTCCCATGAGGACTCTTGAGG - Intergenic
1104177396 12:126346277-126346299 AGGTCCAAGGGGGCCTCTGGTGG - Intergenic
1109278812 13:60331803-60331825 TGGTCCCATTATGCCTGAGGAGG + Intergenic
1113912597 13:113850651-113850673 ACGGCTCATGAGGCCTCTGGGGG - Intronic
1113948193 13:114056627-114056649 GGGTCCCGTGAGGCTTCTGGTGG + Intronic
1114711322 14:24781270-24781292 GGGTCACAGGATGCCTCTGTGGG + Intergenic
1121005778 14:90489729-90489751 TGGTCCCAGGATGCCTATGCTGG - Intergenic
1128255246 15:66191421-66191443 TGGCACCAGGATGCCTCTGGGGG + Intronic
1129726032 15:77902203-77902225 AGGCCACAGGATGGCTCTGGTGG - Intergenic
1130053033 15:80499636-80499658 AGGTCACATTTTGCCTATGGAGG + Intronic
1130274089 15:82467570-82467592 AGGCCACAGGATGGCTCTGGCGG - Intergenic
1130466436 15:84194944-84194966 AGGCCACAGGATGGCTCTGGCGG - Intergenic
1130497828 15:84478592-84478614 AGGCCACAGGATGGCTCTGGCGG + Intergenic
1130588731 15:85199537-85199559 AGGCCACAGGATGGCTCTGGCGG - Intergenic
1132223551 15:100123478-100123500 AGGTCCCATGAGGCCTCCAGGGG + Intronic
1132295017 15:100728520-100728542 AGGTCACATGATGCATTTGATGG - Intergenic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1136172736 16:28498293-28498315 GGGTCCCATCATGCCTCAGAGGG - Exonic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1141362324 16:83407257-83407279 AGGTAAGATTATGCCTCTGGAGG - Intronic
1141720386 16:85752270-85752292 AGGTCCCATCCTGCCTCCGGAGG - Intergenic
1142900694 17:3009661-3009683 AGCTGCCAAGATGCCTCTTGGGG + Intronic
1144300766 17:13921648-13921670 AGGTCACATAATGACTCAGGAGG + Intergenic
1147654751 17:42082487-42082509 TGGTCCCAGGATTCCTCTTGTGG + Intergenic
1149649634 17:58268802-58268824 AGATCCTGTGATGCCTCTGAAGG + Intergenic
1149875087 17:60224587-60224609 AGGTCTCATGTTGCCTGTGCTGG - Intronic
1151175423 17:72284213-72284235 AGGCCCTCTGATGCCCCTGGAGG - Intergenic
1152469035 17:80480849-80480871 ATGTTCCATGCTGCCTCTGGAGG + Intergenic
1152895366 17:82907847-82907869 AGGTCCTGTGATGCCTCCTGAGG - Intronic
1155563528 18:27107255-27107277 AGTCCCCATGATACCACTGGCGG - Intronic
1155986527 18:32236267-32236289 GGGTCCCATCATGCCTCAGGAGG + Intronic
1157484665 18:48078390-48078412 AGGACCTCTGCTGCCTCTGGGGG + Intronic
1158221298 18:55153706-55153728 AGGTTCCCTGATGTCTCTTGGGG + Intergenic
1158436623 18:57438918-57438940 ATGTCCCAGGCTGTCTCTGGTGG + Intronic
1159835741 18:73333119-73333141 GGATCCAATGATGCTTCTGGGGG - Intergenic
1161184398 19:2906837-2906859 AGCTGCCCTGATGCCTCCGGTGG - Intronic
1161310900 19:3593353-3593375 AGGTCACTTGCTGCTTCTGGGGG - Exonic
1167639659 19:50673684-50673706 AGGGCCCATGATGCTTTTAGGGG + Intronic
927804783 2:26137740-26137762 AGGTCACCTGATTCCTCAGGGGG + Intergenic
927824987 2:26302140-26302162 AGTTCCCCTGCTGCCTGTGGAGG + Intergenic
928231848 2:29505256-29505278 AGCCCCCAGCATGCCTCTGGGGG + Intronic
928260701 2:29764031-29764053 AGGTCACAGGATGTCTCTGAGGG - Intronic
929756164 2:44767560-44767582 AGGTTCCATTTAGCCTCTGGGGG + Intronic
932218125 2:69979738-69979760 AGCTCCCATGGTGCCTGAGGAGG - Intergenic
936693980 2:114926085-114926107 AGGTCCAATTCAGCCTCTGGAGG + Intronic
938769600 2:134489873-134489895 AGGTCCCAGGCAGCCTCTGTTGG + Intronic
941198075 2:162474900-162474922 AGCTGCCATGATTGCTCTGGAGG + Intronic
941756450 2:169191715-169191737 AGGGCCCATGATGCTTTTAGTGG - Intronic
943525790 2:189015600-189015622 AGATCCCAGAATGCCTCAGGGGG + Intergenic
943923104 2:193736282-193736304 AGGTGCCATGATGGCTTTGAAGG - Intergenic
944536697 2:200717385-200717407 ATGCCCCATCATGCCTCAGGTGG + Intergenic
1170011340 20:11727418-11727440 AGGTCCCATGAGGTGTCTGATGG + Intergenic
1171481666 20:25459685-25459707 CGGTCCCAGGATGGCTGTGGGGG - Intronic
1171799715 20:29600575-29600597 AGAGCCCATGCTACCTCTGGGGG - Intergenic
1172012268 20:31852458-31852480 AGGTACCATCCTGCCCCTGGAGG - Intronic
1173407499 20:42779270-42779292 AGGACCCATGATGTCTCTTGAGG + Intronic
1175656715 20:60777083-60777105 TGGGCCCAAGATGACTCTGGAGG + Intergenic
1175787769 20:61722973-61722995 AGGACCCAGGATGTCTGTGGTGG - Intronic
1177885973 21:26746590-26746612 AGGTAGCATGAAGCCTCTTGAGG - Intergenic
1178288399 21:31345074-31345096 AGGTTAAATGATGCCTCAGGTGG + Intronic
1180749920 22:18117392-18117414 AGTCCCCATGATGCGTGTGGTGG + Intronic
1181801196 22:25348929-25348951 AGGACCCAGGAGGCCTCAGGGGG - Intergenic
1181814791 22:25429905-25429927 AGGCCCCAGGAAGCCTCAGGGGG - Intergenic
1182010247 22:26994814-26994836 AGGTTTCATAATGCCTCTGGTGG + Intergenic
1182912871 22:34001993-34002015 ATGTCCCATGACACATCTGGAGG - Intergenic
1183021815 22:35033516-35033538 AGGTCCCAGGATGCAGCAGGCGG + Intergenic
1183035639 22:35139153-35139175 AGGCCTCATGGGGCCTCTGGAGG - Intergenic
1184800850 22:46758277-46758299 AGGTCACAGGATGCCTCTGTTGG - Intergenic
1184889787 22:47372586-47372608 AGCATCCATGATGCATCTGGAGG - Intergenic
952344936 3:32474317-32474339 AGGTCCCATTCTGCTTCTAGTGG + Intronic
952751823 3:36831083-36831105 AGGCCACTTGCTGCCTCTGGTGG + Exonic
953454707 3:43032395-43032417 TGGTCCCATGGAGCCTCAGGGGG + Exonic
956712638 3:72051755-72051777 AGATGCCATCATCCCTCTGGTGG + Intergenic
957461975 3:80533444-80533466 AAGTCCCATGATGTCACTGGAGG - Intergenic
960393821 3:117111790-117111812 CGGTCCTATGAAGCCTTTGGGGG - Intronic
962045087 3:131750055-131750077 AGGCCCCATGATGAGACTGGTGG - Intronic
962961386 3:140314491-140314513 AAGTCCCATGAGGCCTCTAGGGG - Intronic
969038597 4:4276135-4276157 ATGTTCCCTGATGCCTCTGGAGG + Intronic
972128276 4:35798316-35798338 AAGCCACATGATGCATCTGGAGG + Intergenic
980017883 4:127674388-127674410 AGGTGCCATGAAGCCTCAGCTGG + Intronic
982211661 4:153041947-153041969 TGGTCCTATGATCCCTCTGCTGG + Intergenic
983863124 4:172733449-172733471 AGCTCCCATAATCCCTATGGGGG + Intronic
985840538 5:2301965-2301987 ATCTCCCATGTTCCCTCTGGGGG + Intergenic
986055799 5:4135745-4135767 ACGTCCCAACATGCCCCTGGCGG - Intergenic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
987878485 5:23711291-23711313 AGGTCCCATATTGACTGTGGTGG - Intergenic
988860479 5:35272858-35272880 AGGTAGCATGAAGCCTCTTGAGG - Intergenic
991731427 5:69593228-69593250 TGGTTCCTTGATGCCTGTGGAGG - Exonic
991807859 5:70448383-70448405 TGGTTCCTTGATGCCTGTGGAGG - Intergenic
991863523 5:71034625-71034647 TGGTTCCTTGATGCCTGTGGAGG + Intergenic
992062913 5:73074604-73074626 ATGTCCCATGATAAATCTGGGGG - Intronic
994804538 5:104427769-104427791 AGGCCCCATGATGCCTTTGAGGG + Intergenic
997984328 5:138491343-138491365 AGGCCCCAAGATGCCTAAGGAGG + Intergenic
998162313 5:139820528-139820550 AGGTCCCAGGGTGCCTTAGGAGG + Intronic
998884970 5:146684652-146684674 AGTTTCCACGATGCATCTGGAGG - Intronic
999859913 5:155633839-155633861 GGGACCCATGATGCCTCTTCTGG + Intergenic
1000700654 5:164445028-164445050 ATGTCCCATGATGCCTAGGGTGG - Intergenic
1004868089 6:19874102-19874124 AGGTCTCAAGAGGCCTCTTGGGG - Intergenic
1006375005 6:33667173-33667195 AGGTCCCCTGGTGCGGCTGGAGG + Exonic
1009661119 6:66612688-66612710 AGGTACCTTAGTGCCTCTGGTGG - Intergenic
1014509870 6:122307849-122307871 AGGTCCCATTGAGCCACTGGTGG - Intergenic
1019815018 7:3193315-3193337 TGGTCACATGATGCCACTTGGGG - Intergenic
1023136683 7:37059742-37059764 TGGTGCCATGAGGTCTCTGGTGG - Intronic
1025599474 7:62977337-62977359 AGGTTCCCTGATGCCCCTTGAGG - Intergenic
1025715403 7:63951391-63951413 AGGGCCCATGGTGCCTCCAGAGG + Intergenic
1035394226 7:158524931-158524953 AGTTCCGATGAGGCCACTGGGGG + Intronic
1035905009 8:3499983-3500005 AGGGCCTATGAGGCCTGTGGGGG + Intronic
1038596324 8:28890040-28890062 AGTTCCCATGATGCCTGGAGGGG - Intronic
1039440415 8:37591386-37591408 AGGTCCCTTCATGGCTTTGGAGG + Intergenic
1039711362 8:40059001-40059023 AGGTCTAATGACGACTCTGGTGG - Intergenic
1040621193 8:49095113-49095135 AGGTGCCCTGCTGCCTCTTGCGG + Intergenic
1046651470 8:116840695-116840717 TGGGCCCATCATGACTCTGGAGG - Intronic
1047348144 8:124048443-124048465 CAGCCCCATGCTGCCTCTGGGGG + Intronic
1055747921 9:79471179-79471201 TGCTCCCTTGCTGCCTCTGGCGG - Intergenic
1059436991 9:114282962-114282984 AGGTCCCTGGATGACTCTGAGGG + Intronic
1060527836 9:124330534-124330556 AGGGCCCGTGCTGCCTCTTGGGG + Intronic
1060674072 9:125496570-125496592 TGGTTCCATGCTGCTTCTGGAGG - Intronic
1186980564 X:14953740-14953762 AGCCCCCATGATGGGTCTGGTGG - Intergenic
1187157490 X:16734455-16734477 ATGTCCCATGATAAATCTGGGGG - Intronic
1189380675 X:40500261-40500283 AGGAGCCATGAAGCCACTGGTGG + Intergenic
1189718162 X:43885845-43885867 ATGTCTCATGATGCCACAGGCGG + Intergenic
1191061204 X:56298501-56298523 AGGTGCCTGGATGCTTCTGGAGG - Intergenic
1200034536 X:153319140-153319162 AGGTCCCCCGACGCCCCTGGGGG - Intergenic
1202270070 Y:23062888-23062910 AGGGCCCATGGTTCCTCTAGAGG - Intergenic
1202295957 Y:23357794-23357816 AGGGCCCATGGTTCCTCTAGAGG + Intergenic
1202423064 Y:24696633-24696655 AGGGCCCATGGTTCCTCTAGAGG - Intergenic
1202447725 Y:24973453-24973475 AGGGCCCATGGTTCCTCTAGAGG + Intergenic