ID: 987777853

View in Genome Browser
Species Human (GRCh38)
Location 5:22392628-22392650
Sequence GACTTGAATGAGATGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987777853 Original CRISPR GACTTGAATGAGATGAAGCA TGG (reversed) Intronic
901705831 1:11072391-11072413 GGATTGAATGAGATGATGGATGG - Intronic
902915916 1:19639334-19639356 GATTATAATGAGATGGAGCAAGG - Intronic
903231563 1:21925510-21925532 GACCTGACTGAGAAGAATCAGGG + Intronic
903311637 1:22462792-22462814 GACTGGAATGAGACTAAGCCAGG - Intronic
903671553 1:25038901-25038923 AGGTTGAATGAGATGAATCAAGG - Intergenic
906542816 1:46601216-46601238 GACTTGATTGAGATTACACAAGG - Intronic
906820207 1:48921225-48921247 GACTGGCATGTGAGGAAGCAGGG + Intronic
907510529 1:54954681-54954703 GACTTGAAGGATAGAAAGCAAGG - Intergenic
908953500 1:69591752-69591774 AACAAGAATCAGATGAAGCAAGG + Intronic
909209217 1:72801215-72801237 AAATTAAATGAGATGGAGCATGG + Intergenic
909559328 1:76992270-76992292 GACTAAAATCAGATGAAGCAGGG - Intronic
911198393 1:95018770-95018792 GACTTCACAGAGATGAATCATGG + Intronic
911818138 1:102381050-102381072 GAGTTGAGTAAGATAAAGCAAGG - Intergenic
913010346 1:114677293-114677315 GACTTGAAGCAGATGAGACAAGG + Intronic
914715968 1:150255494-150255516 AACTTGACTGAGATGAGGCGTGG - Intergenic
914817103 1:151071132-151071154 GACTGGAAGGAGGTGAAGAAGGG + Intronic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
916488758 1:165282656-165282678 CACGTGAATGAGTGGAAGCATGG - Intronic
917182207 1:172311072-172311094 GGATTGAATGAGATAATGCAGGG + Intronic
918550793 1:185739917-185739939 GACTTGAAGGAGGTGAGGGAGGG + Intronic
919385708 1:196920677-196920699 AACTTGAAAGAGATGATTCAAGG + Intronic
919994210 1:202733029-202733051 GACTTACATGAGAAGAAGCAGGG + Intronic
920294797 1:204949343-204949365 GACTTGAGTGAGATGTGGCGAGG - Intronic
923586152 1:235273444-235273466 GACTTAAATTAGATGAAATATGG - Intronic
924603771 1:245514860-245514882 GAATTAAATGAGATAATGCATGG + Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1064753904 10:18557881-18557903 GAATGGAATGAAATGAAGAATGG + Intronic
1064755691 10:18570310-18570332 GAATAGAATGAAATGAAGAATGG - Intronic
1065480963 10:26193489-26193511 GGCTTGAATGTGAGGAAGAAGGG - Intronic
1065837221 10:29669573-29669595 GAGGTGGATGAGAAGAAGCATGG + Intronic
1067438121 10:46292965-46292987 CACTTGTCTGAGATGAAGGAGGG + Intronic
1068037060 10:51773732-51773754 GAATTAAATGAGATGAATAATGG - Intronic
1071074723 10:81736347-81736369 CAAATGAATGAAATGAAGCAAGG + Intergenic
1071791572 10:88959754-88959776 GACTTGACTTAAATGCAGCATGG - Intronic
1073525367 10:104176676-104176698 GACTCAAATGAGATCAAGCAAGG + Intronic
1073551444 10:104405799-104405821 TTCTTGAATGGAATGAAGCAGGG - Intronic
1074300745 10:112231492-112231514 GACTTGAACGATGTGAAGGAGGG + Intergenic
1075038626 10:119089875-119089897 GACTTTAATGAGGTGAGGGAAGG - Intergenic
1078329883 11:10410515-10410537 GACTTGATTGATTTGAAACATGG - Intronic
1081503457 11:43690035-43690057 GACTTGAAGGAGAGTAAGAAGGG - Intronic
1081582950 11:44365055-44365077 AAATTGAGTGAGATGGAGCAGGG - Intergenic
1081654890 11:44850619-44850641 GAGTTCAATGAGAAGATGCAAGG - Intronic
1082920482 11:58487203-58487225 GTCTTTAATGAGATCAAGCCTGG + Intergenic
1083214184 11:61208188-61208210 GTCCTGCATGAGATGAACCAGGG + Intronic
1083217068 11:61227017-61227039 GTCCTGCATGAGATGAACCAGGG + Intronic
1083219950 11:61245843-61245865 GTCCTGCATGAGATGAACCAGGG + Intronic
1083605543 11:63976406-63976428 GAATTGAATGACATGATCCAGGG - Exonic
1085262119 11:75212243-75212265 AGATTGAATGAGATGATGCAAGG - Intergenic
1085281422 11:75333602-75333624 GGCTTAAATGAGATAATGCATGG - Intronic
1085777170 11:79377433-79377455 GCTGTGAATGAGATGAAGCCTGG - Intronic
1086314391 11:85575040-85575062 GAATTGACTGAGAGGATGCAAGG - Intronic
1086435355 11:86774762-86774784 GATTTAAATGAGATAATGCATGG + Intergenic
1086989852 11:93291003-93291025 GACAGGAATGAGATGGAGGATGG + Intergenic
1086998822 11:93392044-93392066 GAATAGAATCAGATGAAGGAAGG + Intronic
1089873836 11:121701088-121701110 GCCTTGAAAGAGATAAAGCATGG - Intergenic
1090683958 11:129094909-129094931 GTATTAAATGAGATGATGCATGG + Intronic
1090809784 11:130227310-130227332 TACTTGAATGAGATGACGACTGG + Exonic
1095857045 12:46871783-46871805 GGCATGGATGAGATCAAGCAGGG - Intergenic
1096858507 12:54504787-54504809 GAATTAAATGAGATAATGCATGG + Intronic
1097759535 12:63446371-63446393 GACTTGGGCGAGATGAACCATGG - Intergenic
1098687116 12:73435622-73435644 GACTTGTAGAAAATGAAGCAAGG - Intergenic
1101083059 12:101208826-101208848 GGATTAAATGAGATGATGCAAGG - Intronic
1101252805 12:102951794-102951816 GACTCAAATGAGAAGAAGGAGGG - Intronic
1101822969 12:108197967-108197989 GACTTGAAGGAAAGGAAGAAGGG - Intronic
1102374537 12:112411002-112411024 GAATTAAATGAAATAAAGCAAGG - Intronic
1103041503 12:117699310-117699332 GAATTAAATGAGATAATGCATGG - Intronic
1103166983 12:118778682-118778704 GACAGGTATGAGATGAAGCTGGG + Intergenic
1103599066 12:122042733-122042755 GACTTGAATGTCATGAGGCAGGG - Intronic
1104385767 12:128350448-128350470 GACTTGAGTGAAGTGAAGAAGGG + Intronic
1105585678 13:21740767-21740789 GAGTTAAATGAGATGACACAAGG - Intergenic
1105771548 13:23617081-23617103 GGCTTGAAGGAGACGAGGCACGG + Intronic
1108437191 13:50412018-50412040 TACTTGAAAGAGATGTACCAGGG - Intronic
1108697621 13:52916601-52916623 GATTTGAGGGAAATGAAGCAAGG + Intergenic
1108938907 13:55924072-55924094 GTATGTAATGAGATGAAGCAAGG - Intergenic
1110175247 13:72548632-72548654 GACTTGAAAGGGTGGAAGCATGG + Intergenic
1110526926 13:76549050-76549072 AACTTGAATCAGAAGAAACAGGG + Intergenic
1111224444 13:85251587-85251609 GCCTGGAATGAGATAAAGCTTGG + Intergenic
1111498289 13:89083181-89083203 GACTTAAATGAGACTAAGCCAGG - Intergenic
1111859233 13:93680557-93680579 GAGTTGAATGGGATTAAGGAGGG + Intronic
1111901681 13:94207229-94207251 GACGTGAATGCCATGAAGGAAGG - Intronic
1112368126 13:98773069-98773091 GACAGGGATGAGGTGAAGCAGGG + Intergenic
1112873074 13:103999211-103999233 CACTTGAATGAAATGAACCCAGG + Intergenic
1112999133 13:105611844-105611866 GACTGGAATGAGATAAAGTTTGG + Intergenic
1114382397 14:22221290-22221312 GACTTAAATGAACTGAAGAAAGG - Intergenic
1115192349 14:30759125-30759147 GACTTGAAGGAGATGAAACTTGG + Intergenic
1116599914 14:46907656-46907678 GACATGAATGATATGAAAAATGG - Intronic
1116678105 14:47931615-47931637 GGATTAAATGAGATAAAGCATGG + Intergenic
1117199005 14:53369561-53369583 TAATTAAATGAGATGAAGTATGG + Intergenic
1117539914 14:56736894-56736916 GACTTGAATAAAATGCAGTATGG - Intergenic
1118565303 14:67133905-67133927 GACTTGAGTGAAATGAATAACGG - Intronic
1118878485 14:69805513-69805535 TAACAGAATGAGATGAAGCATGG + Intergenic
1118997495 14:70850004-70850026 GACATCATTGGGATGAAGCAAGG - Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121146685 14:91590121-91590143 GAATTAAATGAGATAAATCACGG + Intronic
1121510627 14:94510270-94510292 GGCTTGAATGACATTTAGCACGG - Intronic
1123724573 15:23089226-23089248 GACTTGAGAGAGAGGGAGCAGGG - Intergenic
1124066773 15:26352250-26352272 GACCTGGATGAGAGGAAACAGGG - Intergenic
1124151472 15:27182612-27182634 GAGTTGAATGAGATGACGGGAGG + Intronic
1127811069 15:62566092-62566114 GAAATGACTGAGATAAAGCATGG + Intronic
1128960322 15:71996638-71996660 GACTTGAATAATGGGAAGCAAGG - Intronic
1129557911 15:76532520-76532542 GACTTGAATGAGAGAAAATATGG - Intronic
1130753785 15:86741422-86741444 GAATTCAACCAGATGAAGCATGG + Intronic
1133234998 16:4383673-4383695 GGCTTGAATGAGGTGAGGCTGGG + Intronic
1133381705 16:5336451-5336473 GGATTGAATGAGATCATGCATGG + Intergenic
1133582842 16:7163194-7163216 GACTTGCCTGAGTTAAAGCAGGG + Intronic
1134060084 16:11194272-11194294 GGCTTGAATTAGAAGAAGGATGG + Intergenic
1137373429 16:47929863-47929885 GAGATAAATGGGATGAAGCATGG + Intergenic
1137538923 16:49348827-49348849 GGATTGAATGAGATCATGCAGGG + Intergenic
1138510355 16:57505202-57505224 GACTGGAAGGATATGAAGGAGGG + Intergenic
1139052123 16:63137257-63137279 GTCTTGAATGATATGAAAAAGGG + Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1141621875 16:85240616-85240638 GACTTAAACGAGATGGTGCATGG + Intergenic
1144258005 17:13488915-13488937 AACTGGAATGAAATGAAGGAAGG + Intergenic
1144272775 17:13634649-13634671 GATAAGAATGAGATGAGGCAGGG + Intergenic
1146735904 17:35238848-35238870 GACTTGACTGAAATTAAGCTTGG + Intergenic
1146799687 17:35808802-35808824 GAATTAAATGAGATGATGTAAGG + Intronic
1148439319 17:47703425-47703447 GACTTGAAAGAAAGGAAGTAGGG - Intronic
1149733289 17:58968129-58968151 AACTTTAATGACATGAAGGACGG - Intronic
1150959832 17:69901167-69901189 GACTCAAAAGAGATGGAGCAAGG - Intergenic
1153665725 18:7366526-7366548 GGCTTGCATGAAATGAAGCCTGG - Intergenic
1153703224 18:7717483-7717505 CACATGAATGAACTGAAGCATGG - Intronic
1155280854 18:24238169-24238191 GACAGGAAAGAGAGGAAGCATGG - Intronic
1155509579 18:26563072-26563094 GACATAAAGGAGAGGAAGCAGGG - Intronic
1157277281 18:46320389-46320411 AACAAGAAAGAGATGAAGCAGGG + Intergenic
1157453346 18:47804344-47804366 GACCTGAATGACTTGAAGAATGG - Intergenic
1158304120 18:56085783-56085805 GTGTTCAATGAGATGATGCATGG + Intergenic
1158372735 18:56827898-56827920 GGATTAAATGAGATGATGCATGG + Intronic
1158377891 18:56893027-56893049 GTCTAGAATGTGATGCAGCATGG + Intronic
1158586973 18:58747743-58747765 TACTAAAATGACATGAAGCATGG - Exonic
1159251394 18:65881801-65881823 TACATGAAGGAAATGAAGCATGG + Exonic
1159412791 18:68103889-68103911 GAATTGAATGGGTAGAAGCAAGG + Intergenic
1159564135 18:70029053-70029075 CACTTTATTGAGATGAAACATGG - Intronic
1159566679 18:70058875-70058897 CAATTGAATGAGGTGAAACAAGG + Intronic
1161204129 19:3031764-3031786 GACTTGAATGATAAGAAGCAAGG - Intronic
1161658819 19:5533375-5533397 GACCTGAAGGAGAGGAAGAAGGG + Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1162156363 19:8680788-8680810 GACTTGAGAGAGATGAAGGGGGG + Intergenic
1162296560 19:9818287-9818309 GACTTCACTGAGATCACGCAGGG - Intronic
1164485353 19:28651104-28651126 GACTTGAATGAAGTGCAGCAGGG + Intergenic
1165403879 19:35618446-35618468 CACCTGGATGAGATGAACCATGG - Exonic
1166070665 19:40385496-40385518 GACCTGAAGGAGGTGAGGCAGGG - Intronic
1168344753 19:55644697-55644719 GCCTTGGAGGAGATGAAGCCTGG - Exonic
1168542765 19:57226693-57226715 GACTTGTATGAGATGAGGGTTGG - Intergenic
926646852 2:15299064-15299086 GACTTCAGTGACATGACGCATGG + Intronic
926779280 2:16452622-16452644 AACTAGACTGAGATGATGCAGGG - Intergenic
928481520 2:31689128-31689150 GACTTGAATGTGATGTATCCAGG + Intergenic
928721523 2:34126591-34126613 GACTGAAATGAGTTGAAGGAAGG + Intergenic
929291415 2:40196253-40196275 GAGTTGAATGAAATGACACATGG + Intronic
930255218 2:49082757-49082779 GAAATGAATGAAATGAAGCGAGG + Intronic
930948468 2:57106404-57106426 GGTTAGAATGAGATGAAGTAGGG + Intergenic
931745960 2:65292345-65292367 GAATAAAATGAGATGATGCATGG - Intergenic
932528350 2:72498155-72498177 GATCTGAATGACATGAACCAAGG + Intronic
932905472 2:75745584-75745606 GCCATGAATGAGATGAAGGTTGG + Intergenic
933384095 2:81588415-81588437 GACATGATAGAGAGGAAGCAGGG - Intergenic
933660860 2:84926124-84926146 ATCTTGAATGAGATGAAGACGGG + Intergenic
938582683 2:132661435-132661457 GAATGGAATGGGATGCAGCATGG - Intronic
938672605 2:133600136-133600158 AACTTGAAAAAGCTGAAGCATGG + Intergenic
939254540 2:139725172-139725194 GACATGACTTAGGTGAAGCAAGG - Intergenic
939837946 2:147152201-147152223 GAAATGAATGAAATGAAGAAGGG + Intergenic
941192168 2:162398574-162398596 GACCTGAATTAAATTAAGCATGG + Intronic
941256613 2:163240383-163240405 GACTTGAATAAGCAGAAGAAGGG - Intergenic
942166342 2:173244526-173244548 GACTTGCCTGGGATGAGGCAAGG + Intronic
943135917 2:183912864-183912886 TACTTAAGTGTGATGAAGCATGG - Intergenic
945677852 2:212877101-212877123 CAAATGAATGAAATGAAGCAAGG + Intergenic
1168769603 20:407217-407239 GACTTGAGTGGAATGAGGCAGGG + Intergenic
1169682037 20:8226423-8226445 GACATGAATGAGGAGAAGCTGGG + Intronic
1169898700 20:10531972-10531994 GAGTTATAGGAGATGAAGCAGGG - Intronic
1170115256 20:12851205-12851227 AACCTGAAGGAGAGGAAGCAGGG - Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1173016117 20:39227361-39227383 GACTGGAGGAAGATGAAGCATGG - Intergenic
1174165321 20:48579944-48579966 GACTTGAGCCAGATGAAGGAAGG + Intergenic
1174377181 20:50133760-50133782 GCCATGAAAGAAATGAAGCAGGG - Intronic
1175041629 20:56057635-56057657 GACAAGAAAGGGATGAAGCAAGG + Intergenic
1175288862 20:57859921-57859943 GACTGGAAAGAGAGGAAGGAGGG - Intergenic
1177277902 21:18939758-18939780 GACTTGAATGACGTGTGGCAAGG - Intergenic
1178748798 21:35280962-35280984 AACTGGAATGAGATGATGCATGG - Intronic
1178809399 21:35867614-35867636 GTCTTCATTGAGAAGAAGCAGGG + Intronic
1181587119 22:23859032-23859054 GAATTCAATGAGATCATGCATGG - Intronic
1182156973 22:28083685-28083707 ACCGTGCATGAGATGAAGCAGGG + Intronic
1183334334 22:37237986-37238008 GAACTGAATGACAGGAAGCAGGG + Intronic
1185009061 22:48302998-48303020 GACTTGGCTGAGATGTTGCAGGG + Intergenic
949518369 3:4827265-4827287 GAAATGAAGGAGTTGAAGCAGGG - Intronic
949792562 3:7809306-7809328 GATTTGTAGGACATGAAGCAGGG - Intergenic
950185768 3:10944683-10944705 GACCTGAAAGAGATGTTGCAAGG + Intergenic
950313987 3:11984245-11984267 GGATTAAATGAGATGATGCATGG + Intergenic
951945935 3:28136176-28136198 GATTAGAATGAGAGGAGGCAGGG - Intergenic
953007302 3:38990276-38990298 GAGGTGAGTGAGATGCAGCAGGG - Intergenic
953957083 3:47240022-47240044 GACTTGGGAGAGATGGAGCAGGG - Intronic
955879674 3:63530143-63530165 GACTGGAAGGAGATAAAGGAAGG + Intronic
956359835 3:68435966-68435988 TACTTGATTGAGCTGAAGCAGGG + Intronic
956719815 3:72107930-72107952 GACTTGAGTGAGATAATGCCTGG + Intergenic
956903270 3:73739222-73739244 GAATTGAATGAGATAATCCATGG + Intergenic
958193577 3:90213929-90213951 GGCTGGAATTTGATGAAGCAAGG - Intergenic
958905066 3:99932987-99933009 GACTTGAATGAGCTAATACATGG - Intronic
959765342 3:110020516-110020538 GACTTGAGTGGGATGAAGGGTGG - Intergenic
960184133 3:114617668-114617690 GACTAGTAGGAGATGAAGTAAGG - Intronic
960198162 3:114796539-114796561 TAATTGAAAGAGATGGAGCAGGG - Intronic
960199216 3:114811667-114811689 CACTTTAATGAGATGAAGTTTGG - Intronic
960973428 3:123155092-123155114 GACCTGAATGACAAGAAGGAAGG - Intronic
961233249 3:125339933-125339955 GCCTGGATTGAGATGATGCAGGG + Intronic
962488368 3:135866569-135866591 GACTGGCATGAGATGTAGCTGGG - Intergenic
965777891 3:172252516-172252538 TACCTGAATGAGATGCAGTAAGG - Intronic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
967009949 3:185423397-185423419 GTCTTAAAAGAGATGAGGCAGGG + Intronic
969231314 4:5833619-5833641 GGATTAAATGAGATGATGCATGG + Intronic
969329781 4:6467551-6467573 GACTTGAGTGAAATGAAAGAGGG + Intronic
971182123 4:24338516-24338538 AACTTGAGTTGGATGAAGCACGG - Intergenic
972615456 4:40694021-40694043 GACTTGAAGGAAATGAGGGAAGG + Intergenic
974392125 4:61284891-61284913 AATTTGAATGACATGAAGAAAGG - Intronic
974662608 4:64912891-64912913 GGCTTGAAGGTGAGGAAGCAAGG - Intergenic
976429708 4:84948148-84948170 GAGTTGGATAAGAGGAAGCAAGG - Intronic
977128230 4:93198385-93198407 GACCTAAATGAAATGAAGGAGGG + Intronic
977343210 4:95786639-95786661 GACTTGAATGACATTATTCAAGG + Intergenic
978704053 4:111683983-111684005 GACTTGGAAGAGAGGAAGTAGGG - Intergenic
979815334 4:125095263-125095285 GACTTGAATAAAATGAAACTCGG + Intergenic
980610438 4:135153687-135153709 GACTTGTATGAGATGACAGATGG - Intergenic
980760881 4:137233065-137233087 GACTTGTAAGAGATGGAGCATGG - Intergenic
981101449 4:140833722-140833744 GACATGAATAACAAGAAGCAGGG + Intergenic
982121710 4:152149732-152149754 GACTTGAATGACATTAAACAGGG - Intergenic
982550162 4:156787712-156787734 GAGATGAATGAGATGGAGTAAGG + Intronic
982587888 4:157265727-157265749 GACCTTTATGAGATGAAGCTGGG + Intronic
982611753 4:157583010-157583032 GATTTGAATGAGATCATGGAGGG + Intergenic
984466481 4:180106119-180106141 GAATTGAATGAGATGACACTTGG + Intergenic
986289599 5:6389090-6389112 GTCTTCAGTGAGATGGAGCAGGG + Intergenic
987280603 5:16410139-16410161 GATTAGAATGAGAGTAAGCAAGG - Intergenic
987777853 5:22392628-22392650 GACTTGAATGAGATGAAGCATGG - Intronic
991281922 5:64924174-64924196 AACTAGAATGAGATGAAGCTGGG - Intronic
991484220 5:67117263-67117285 CATTTGAATGAGACGAAGAAAGG + Intronic
992368478 5:76117517-76117539 TACTTGCAGAAGATGAAGCATGG + Intronic
992507068 5:77397519-77397541 GACATGACTCAGATGAAACAAGG + Intronic
993463872 5:88220347-88220369 GACTTGGATAAGAAAAAGCAGGG + Intronic
994087028 5:95770333-95770355 GGCTGGAATGAACTGAAGCAAGG - Intronic
994621724 5:102172040-102172062 AACTTGAGAGAGATGAAGTAGGG + Intergenic
995242606 5:109902065-109902087 TACTAGACTGAGGTGAAGCAGGG - Intergenic
995646283 5:114316178-114316200 GACTTATAGGAGATGCAGCATGG + Intergenic
996946651 5:129078606-129078628 GACTTCAATCAGATGAAATAGGG + Intergenic
997596344 5:135109643-135109665 GAATTGAATGAGATGAAGGATGG + Intronic
999174517 5:149622506-149622528 GGATTGAATGAGATCATGCATGG - Intronic
999210590 5:149885112-149885134 GACTTGGATGTGAAGAATCAGGG - Intronic
1000179543 5:158794628-158794650 GACTACAATGACATGAAACAAGG + Intronic
1001412895 5:171523459-171523481 GAGTTTAATGAGATGATGGATGG + Intergenic
1001555198 5:172632373-172632395 GAATGAAATGAGATGAAGCTTGG - Intergenic
1001659174 5:173377849-173377871 GACCTGCATGACATGAAGAAAGG + Intergenic
1001942131 5:175748194-175748216 GAGTTGAATGAAGTTAAGCAAGG - Intergenic
1005092999 6:22078888-22078910 GACCTGAAGGAGGTGAAGGAGGG + Intergenic
1005665745 6:28052448-28052470 GACTTGAATCAGAGGGATCAGGG - Intergenic
1007834039 6:44660654-44660676 CAGTTGGATGAGATCAAGCATGG - Intergenic
1008862644 6:56168598-56168620 GAAATAAATGAGATGAGGCAAGG - Intronic
1009350971 6:62678306-62678328 GACTGGAAGGAGATAAAGCTGGG + Intergenic
1011331601 6:86213481-86213503 GACTTGGATGAGAGGAGGGATGG - Intergenic
1012186342 6:96221685-96221707 GACTTAAATGAGACCAGGCATGG - Intergenic
1012260162 6:97079382-97079404 GACATGAATGGGAGGAAGGAGGG - Intronic
1012844840 6:104376005-104376027 GAAATGAATGAAATGAAGCGAGG + Intergenic
1012883119 6:104815332-104815354 AACTTGAAAGAGATGAATTAGGG + Intronic
1013397714 6:109759440-109759462 GACTTAAATGAGACAGAGCATGG - Intronic
1013684598 6:112564881-112564903 GAGATGAAGGAGATGAAGAAGGG + Intergenic
1014070938 6:117181017-117181039 AACTTGAATGGGATGAGGTAAGG - Intergenic
1014090324 6:117397417-117397439 GACTTAAATGAGTTGAAACATGG + Intronic
1014135468 6:117884078-117884100 AACTTGAAAGAGATGATTCAGGG - Intergenic
1015177057 6:130321614-130321636 GTCTTGAATGAGAAAAAACAAGG - Intronic
1015554304 6:134445049-134445071 CACTTGAAAGATATAAAGCATGG + Intergenic
1021008642 7:15434138-15434160 AACTTGAATTATCTGAAGCAGGG - Intronic
1021134372 7:16947977-16947999 GACTTGAAAGAGATGATTTAAGG + Intergenic
1021316087 7:19149025-19149047 TTCTTGAATGAGCTGAAGCCTGG + Intergenic
1027439196 7:78199619-78199641 GACTATAATGAGAGGAAGCGTGG - Intronic
1027638750 7:80707927-80707949 GACATGAATGAAATCATGCAGGG + Intergenic
1028874566 7:95806686-95806708 GATTTGAGTGATCTGAAGCAGGG + Intronic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1030878479 7:114846117-114846139 AACTTGCAAGAGATGAAACAGGG + Intergenic
1031584214 7:123514748-123514770 GACTTGAAAGAAAGGGAGCATGG - Intronic
1031888052 7:127261276-127261298 GACATGAATGCCAGGAAGCAGGG + Intergenic
1032519840 7:132535565-132535587 GAGGTAAATGAGATGAATCAGGG - Intronic
1032598921 7:133272114-133272136 GAATTAAATGAGATCAAACAAGG - Intronic
1034218118 7:149423082-149423104 GACCTGAACGAGAGGAAGCCCGG + Intergenic
1034844240 7:154429768-154429790 GGCTTGAATGAGGTGCAGCGAGG + Intronic
1035873647 8:3163558-3163580 GGCATGAAGCAGATGAAGCAGGG - Intronic
1036106765 8:5849116-5849138 GCCTTGAATGAGAAGCATCATGG - Intergenic
1039684808 8:39788466-39788488 GACTTAAATTATATAAAGCATGG - Intronic
1042634218 8:70855390-70855412 GAAATGAATGAAATGAAGCAAGG + Intergenic
1042766003 8:72322417-72322439 CAAATGAATGAAATGAAGCAAGG + Intergenic
1042841298 8:73126568-73126590 GCCTTAAAGGAGATAAAGCAGGG + Intergenic
1043374285 8:79630816-79630838 GACTTAAATGAGACAAAGCCAGG - Intronic
1045748667 8:105455460-105455482 GAGTGGTATAAGATGAAGCAGGG + Intronic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1048534640 8:135281686-135281708 GATTTGGTAGAGATGAAGCAAGG - Intergenic
1052993173 9:34534290-34534312 GACTGGAATGGGGCGAAGCAAGG - Intergenic
1053316453 9:37055983-37056005 GACTTGAAGGAGAAGGAGCTGGG - Intergenic
1053714673 9:40874863-40874885 GAAATGAATGAAATGAAGCAAGG + Intergenic
1053923711 9:43028054-43028076 GACTTGTTTGAAAAGAAGCAAGG + Intergenic
1054731674 9:68706930-68706952 GACTCTAATGTGATGAAGTAAGG + Intronic
1054731679 9:68706967-68706989 GACTCTAATGTGATGAAGTAGGG + Intronic
1056280665 9:85038450-85038472 GCCAAGAATGAGATGAAGCCTGG - Intergenic
1058920873 9:109613523-109613545 GACTTCTAGGAGAGGAAGCAGGG - Intergenic
1059826552 9:118035888-118035910 GACTTGTATGACAGGAAACAGGG + Intergenic
1060700081 9:125743534-125743556 GACTGTAATAAGATGAAGCAAGG + Intergenic
1060830036 9:126707957-126707979 GAATTGAATGAGATAATGCCTGG - Intergenic
1187669227 X:21651842-21651864 TACTTGAATGAGACTGAGCATGG - Intronic
1187785813 X:22884921-22884943 TAATTGAAGGAGAAGAAGCAGGG - Intergenic
1188598033 X:31925468-31925490 GACATGAAAGAGATGAAACTGGG + Intronic
1189956700 X:46283014-46283036 GACTTGAATGTCAAGAGGCAAGG + Intergenic
1190336794 X:49267458-49267480 GACTTGAAGGAGATGAGGGAGGG + Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192584676 X:72309569-72309591 GAATTAAATGAGATGATGGATGG - Intergenic
1193754131 X:85385621-85385643 GACTTGAAGGAAAGGAAGAAAGG + Intergenic
1193827221 X:86241376-86241398 AACTTGAGAGAGATGAATCAGGG + Intronic
1194267354 X:91771315-91771337 AAGTTGAAAGAGATGTAGCATGG + Intergenic
1195308272 X:103607431-103607453 GAAATGAATGAGATCAAACAGGG + Exonic
1196071907 X:111534070-111534092 GCTTTCAATGGGATGAAGCAGGG + Intergenic
1197778944 X:130140483-130140505 AACTTGAATGAGCTGTATCAGGG + Intronic
1198304725 X:135369104-135369126 AACTTGAAAGAGATGACACAGGG - Intergenic
1199734010 X:150667296-150667318 GACTTAAGGGAGATGAAGGAGGG - Intronic
1200584558 Y:4992252-4992274 AAGTTGAAAGAGATGTAGCATGG + Intergenic
1202302330 Y:23429982-23430004 TACTTAAATGATATGACGCAAGG - Intergenic
1202568481 Y:26240616-26240638 TACTTAAATGATATGACGCAAGG + Intergenic