ID: 987778896

View in Genome Browser
Species Human (GRCh38)
Location 5:22406340-22406362
Sequence TAGGGTAGTGAAGAGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987778896_987778899 23 Left 987778896 5:22406340-22406362 CCTGTAATCTCTTCACTACCCTA 0: 1
1: 0
2: 3
3: 10
4: 125
Right 987778899 5:22406386-22406408 TGCAGCCTGCATGATATTAAAGG 0: 1
1: 0
2: 2
3: 19
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987778896 Original CRISPR TAGGGTAGTGAAGAGATTAC AGG (reversed) Intronic
904805971 1:33132831-33132853 TTGGGTAGTGATGAGAATTCTGG + Intergenic
911320035 1:96402778-96402800 GAGACTAGTGAAGAGTTTACAGG + Intergenic
912387365 1:109278385-109278407 TAGGGTACTGCAGAGGTTTCCGG + Intergenic
916244648 1:162675252-162675274 TAGAATAATGTAGAGATTACAGG + Intronic
917147933 1:171912486-171912508 TAGGATAGTGATGACATTATAGG - Intronic
917614202 1:176721593-176721615 TATGGAAGTGAAAAGATAACGGG - Intronic
918405817 1:184211099-184211121 TAAGGCAGTGGACAGATTACTGG - Intergenic
918553762 1:185774824-185774846 TAGGGTATTGAAGAAAATATTGG + Intronic
919527208 1:198668396-198668418 TAGGGTTTTGAAGACAATACAGG + Intronic
920988340 1:210911879-210911901 GAGGGCAGTGGAGAGATTGCAGG - Intronic
1065065078 10:21954330-21954352 TAGGCTAGTGAAGACATTTTTGG - Intronic
1068965016 10:62903097-62903119 TAGTGTAGAGGAGAGAGTACTGG - Intronic
1072173814 10:92895816-92895838 TAGTGTAGTGTTGGGATTACAGG + Intronic
1074635245 10:115307744-115307766 TAGAGTAGTGAAGAAATGCCAGG + Intronic
1075164501 10:120054938-120054960 TATGGTAATGATGAGATTGCAGG + Intergenic
1076056319 10:127376370-127376392 TAGGCTACTGTAGAAATTACTGG + Intronic
1076069133 10:127472157-127472179 GAGGGTTGTGAAGAGTATACAGG + Intergenic
1078742317 11:14078571-14078593 TAATGTAGTGCAGAGATTAAGGG + Intronic
1080297210 11:30744045-30744067 TAGGGTAGGGAAAAGATTTTTGG + Intergenic
1082960083 11:58911010-58911032 TAGAGTAACGAAGAGATTAGTGG - Intronic
1082980029 11:59112194-59112216 TAGAGTAATGAACAGATTAGTGG - Intronic
1083421314 11:62554772-62554794 TAGGGGAGTGAAGAGAGCCCAGG + Intronic
1083821105 11:65171918-65171940 GAGGGTAGAGAAGACATGACAGG - Intronic
1085648897 11:78249107-78249129 TAGCATAGTGAAAAGAGTACAGG + Intronic
1087085920 11:94218943-94218965 GAGGGTAAGGAAGAGATGACTGG - Intergenic
1087242559 11:95796373-95796395 TAGGGTCATGGAGAGATTAGTGG + Intronic
1088928237 11:114323513-114323535 GAGGCTAGTGAGGAGATGACTGG + Intergenic
1089922247 11:122220405-122220427 TGGGGTAGTGGAAAGAATACTGG - Intergenic
1097369406 12:58758273-58758295 TAGGGTAGTGAAGGGAATGAGGG + Intronic
1098092355 12:66917287-66917309 TAGGCAAGTGTAGAGATTATTGG - Intergenic
1100018708 12:90043870-90043892 TAGGGAAGAGAAGAAATTATTGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1103517025 12:121514715-121514737 TAGGGGAGTGAAGATATTAGGGG - Intronic
1105050544 12:133046273-133046295 TGGGATAGTGATGAGATTAAAGG - Intronic
1108680129 13:52772973-52772995 TGGTGTAGTGAAGAGATAAGAGG - Intergenic
1111285512 13:86086595-86086617 TAGGGTATTAAATAGATTACAGG - Intergenic
1112179639 13:97065886-97065908 AAGGGTGGTGAAGAGATTCAAGG - Intergenic
1114973182 14:28060049-28060071 TATGGTACTGAACAGATTAGTGG + Intergenic
1115127344 14:30012252-30012274 AAGGGTAGTGAGGAGTTTACGGG + Intronic
1117810520 14:59540963-59540985 AAGGATAGAGAAGAGATTTCTGG + Intronic
1126165880 15:45653468-45653490 CAGGGTGGTGCAGAGCTTACAGG + Intronic
1129506754 15:76087953-76087975 TAAGGTTGTGAATAGATCACTGG - Intronic
1131524655 15:93143326-93143348 TAGGGCACTGTAGAGATTAGAGG - Intergenic
1132117897 15:99151017-99151039 TACGGGAGTGAAGAGATTTAGGG - Intronic
1133100858 16:3478758-3478780 TAGGGGAGTGGAGTGATTCCAGG - Intronic
1140822844 16:78679177-78679199 AAAGGTAGAGAATAGATTACAGG + Intronic
1142624013 17:1180783-1180805 AAGGGCAGTGAAGAGATTGGGGG + Intronic
1144148549 17:12421270-12421292 TAAGGGAGTTAAAAGATTACTGG + Intergenic
1145844097 17:28022671-28022693 TAGCTTAGTGAAGGGAGTACTGG + Intergenic
1145991515 17:29081820-29081842 GGGGGCAGTGAAGAGATTAGAGG + Intronic
1146714552 17:35073820-35073842 TAGGTTAGAGAAGAGTTCACTGG - Intronic
1147315566 17:39618419-39618441 TAGTGCAGTGGAGTGATTACTGG - Intergenic
1149020375 17:51956685-51956707 TAGGGTAGAAAAGAAATTATGGG + Intronic
1154481118 18:14825875-14825897 TAGGGGAGAGAAGAAATTTCAGG + Intronic
1155129407 18:22916478-22916500 TAGGGTAGTGAAAAAATTACTGG - Intronic
1158471356 18:57739843-57739865 TAGGGTACTGAAGATATCAAAGG + Intronic
1158849420 18:61480073-61480095 TGGACTAATGAAGAGATTACAGG + Intronic
1165761908 19:38326569-38326591 TAGGGGAGTAAAGAGAGTAAAGG - Intronic
1167728325 19:51234483-51234505 TAGGGCAGTGGAGAGAGCACTGG - Intronic
926679621 2:15653733-15653755 TAGGGAAGTGAAGAGGGAACTGG - Intergenic
929792097 2:45030982-45031004 TTGGGCAGTGAAGAGATGATGGG - Intergenic
930528160 2:52557880-52557902 TAAGGTACTGAGGAAATTACTGG + Intergenic
932589776 2:73058419-73058441 TGGGGGAGTGAAGAGAATAGGGG - Intronic
932750455 2:74368292-74368314 AAGGGTAGTGATGTGATTACTGG + Intronic
934580456 2:95433853-95433875 TGGGGTAGTGAAGAGAATGCTGG + Intergenic
934598991 2:95642864-95642886 TGGGGTAGTGAAGAGAATGCTGG - Intergenic
936532335 2:113284858-113284880 TAGGGTAGTGAAGAGAATGCTGG - Intergenic
938185498 2:129228398-129228420 TGGGGTAGTGAAAAGATCAAAGG + Intergenic
940281095 2:151990379-151990401 TAGGGAAGTGAGGAGATGTCTGG - Intronic
942650980 2:178167399-178167421 TATGGCAGTGGAGAGATGACAGG - Intergenic
944272839 2:197803362-197803384 TAAAGTAGTGAAGAGATTATCGG + Intergenic
947509664 2:230740245-230740267 TAGGTCAGGGAAGAGAGTACTGG - Intronic
1169941714 20:10944953-10944975 TAGGGTAGTGGTCAGATCACAGG + Intergenic
1173897246 20:46560355-46560377 TAGGGTAGTGTAAAGATTGAAGG - Intronic
1176876559 21:14135823-14135845 TAGGGAAGTTAAGGGAGTACTGG + Intronic
1177473750 21:21592698-21592720 TGGTGTAGTGAAAAAATTACTGG + Intergenic
1177695865 21:24569494-24569516 TAGGGAAGTGAGGATATCACTGG + Intergenic
949155820 3:826567-826589 TGGGGTAGTCAAGAGAGTTCTGG + Intergenic
958925484 3:100152425-100152447 CAAGGTAGAGAAGAGATTAGGGG - Intronic
959421105 3:106129865-106129887 TAGGTTGGTGAAGAGGTTAAGGG + Intergenic
960100692 3:113739619-113739641 AAGGGTAGGGAAGAGATAATTGG - Intronic
962384129 3:134919477-134919499 ACGGGTAGGGATGAGATTACAGG + Intronic
964151928 3:153536158-153536180 GAGGGTAATGAACAGGTTACAGG + Intergenic
966260752 3:177975847-177975869 TTGAATAGTGAAGAGATGACAGG - Intergenic
966334597 3:178854188-178854210 AAGGGCAGTGGAGAGATTGCAGG - Intergenic
969905453 4:10390218-10390240 AAGGATAGTGAAGAGAGTAGGGG - Intergenic
974208388 4:58737449-58737471 TAGTATATTGAAGAGATGACAGG + Intergenic
981114315 4:140971956-140971978 TAGTGTAGAGAAAAGAATACAGG - Intronic
982948523 4:161658928-161658950 AGGGTTAGTGAAGAGATTCCAGG - Intronic
985420020 4:189775883-189775905 AAGGCCAGTGAAGACATTACTGG + Intergenic
986298154 5:6456512-6456534 TAGGAAAGTGTAGACATTACTGG - Intronic
987778896 5:22406340-22406362 TAGGGTAGTGAAGAGATTACAGG - Intronic
990735029 5:58851023-58851045 TGGGGTAGGTAAGAGATTAGAGG - Intronic
990793572 5:59513597-59513619 TAGGGTACAGAAGAAAATACAGG - Intronic
992535358 5:77696276-77696298 TAGAGTAATCCAGAGATTACTGG + Intronic
996583690 5:125061330-125061352 TAGTGTAGTGTAGTGATTAAGGG + Intergenic
999698600 5:154207691-154207713 GTGGGTAGTGAAGGGATTCCAGG + Intronic
1003637357 6:7844991-7845013 TCGGGTAGTGAACAGACCACTGG - Intronic
1004441451 6:15659055-15659077 AAGGGCAGTGTAGAGATTACTGG - Intronic
1005780151 6:29182412-29182434 AGGGGTAGTGAAGAGACTAAGGG + Intergenic
1008922295 6:56855022-56855044 TAGGGTAGTGAAGATAAAGCTGG + Intronic
1011441178 6:87388910-87388932 TAGTGTAGTGAAAAGGGTACTGG + Intronic
1012951592 6:105523456-105523478 GAACGTAGTGAAGAGAATACAGG - Intergenic
1013423747 6:109991396-109991418 TGGGGCAGGGAAGAGAGTACGGG + Intergenic
1015396430 6:132739628-132739650 CAGGGTAGTGGAGACAGTACAGG - Intergenic
1022246659 7:28566793-28566815 TTGGGTAGAGAAGAGATTACAGG + Intronic
1024140428 7:46457592-46457614 AAGGGTAGTTAAGAGGTTAAAGG + Intergenic
1024686997 7:51756920-51756942 TAGGGAAGTGAAGACAGTATCGG - Intergenic
1028398731 7:90402087-90402109 TTGGGTGGTGAAAAGATTTCTGG - Intronic
1029916637 7:104216436-104216458 TGGGGTAGTAAAAAGATTAAGGG - Intergenic
1032411757 7:131699008-131699030 TAAGGTAGAGAAGAGAGAACTGG + Intergenic
1032686159 7:134235840-134235862 TAGGTTATTGAAAAGATTAAAGG + Intronic
1036575494 8:10024283-10024305 TAGTGTAGTGAAAAAAATACAGG + Intergenic
1037213006 8:16415105-16415127 AAGGGTAGTGAGGAAAATACAGG + Intronic
1039026012 8:33258878-33258900 TAGGGTAGTGGAGAGAGCATTGG + Intergenic
1042221496 8:66478721-66478743 AAGGGTGGTGAAGAGGTGACAGG - Intronic
1043224600 8:77709002-77709024 TAGGTTGGGGGAGAGATTACTGG + Intergenic
1044533624 8:93336009-93336031 TTGGGTAGTGAACAGAATAGTGG + Intergenic
1045020041 8:98034584-98034606 GAGGGTACTGAGGAGCTTACAGG + Intronic
1045964281 8:108005773-108005795 TTGGGTCTTGAAGAGAATACAGG + Intronic
1048578780 8:135713743-135713765 TAGGGAAGGGAAGAGAAAACCGG + Intergenic
1050035135 9:1427323-1427345 TGAGGTAGTGAAAAGACTACGGG + Intergenic
1052042518 9:23755299-23755321 TAGTTTAGTGGAAAGATTACAGG - Intronic
1053118677 9:35528450-35528472 TATGGTAATCAAGACATTACAGG - Intronic
1055113576 9:72584315-72584337 TAGTGCAGTGATGAGATCACAGG + Intronic
1056338621 9:85601895-85601917 TAAGCCAGTGAAGAAATTACAGG + Intronic
1059360283 9:113736816-113736838 AAGGGTGGTGAAGAGATTAAGGG + Intergenic
1060175654 9:121495658-121495680 TTGGGTAATTAGGAGATTACTGG - Intergenic
1186720946 X:12303048-12303070 TAGGGAAGGGGAGAGGTTACAGG + Intronic
1191854138 X:65609160-65609182 TAGGGAAGGGAAGAGATTGTTGG + Intronic
1192753225 X:74016744-74016766 TCCGGTAGTGAAGAGTTTACAGG + Intergenic
1194437722 X:93889128-93889150 TAAGGAATTGAAGAGGTTACAGG + Intergenic
1194938845 X:99985038-99985060 TAGGGTTTTGAAGAGATGAGTGG - Intergenic
1196576756 X:117327388-117327410 TAGGGTACTGATGGGATTAAGGG - Intergenic
1199315697 X:146375102-146375124 TGGTGTAGTGGAGAGAATACAGG - Intergenic
1199843424 X:151673541-151673563 TAGGGTTGTGGAGAGAGCACTGG + Intronic
1200468059 Y:3545941-3545963 TAGGGTGGTTAAGAGAGTGCTGG - Intergenic
1201852275 Y:18498500-18498522 CATGGTACTGAAGAGATAACTGG + Intergenic
1201881046 Y:18821884-18821906 CATGGTACTGAAGAGATAACTGG - Intronic