ID: 987781640

View in Genome Browser
Species Human (GRCh38)
Location 5:22444622-22444644
Sequence AAACACGACTTGGGTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987781635_987781640 13 Left 987781635 5:22444586-22444608 CCTGGTTTGAGGACAGGCTTTAA 0: 1
1: 0
2: 0
3: 13
4: 143
Right 987781640 5:22444622-22444644 AAACACGACTTGGGTAAAATGGG 0: 1
1: 0
2: 0
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987781640 Original CRISPR AAACACGACTTGGGTAAAAT GGG Intronic
900493842 1:2967235-2967257 AAACACGTTCTGGGTGAAATTGG + Intergenic
901901086 1:12363310-12363332 TAACAAGCCTTGTGTAAAATGGG + Intronic
904824925 1:33268184-33268206 AGACAGGACTTGGGTCAATTAGG + Intronic
905079531 1:35305197-35305219 AAATACCACTTGGGTCAAGTTGG + Intronic
909782757 1:79567940-79567962 AAACAAAACTTGAGTAAAATAGG - Intergenic
910309758 1:85810089-85810111 AAACAGGATCTGGCTAAAATAGG + Intronic
911303745 1:96207642-96207664 AAACAAGACTGGGGACAAATTGG + Intergenic
913151033 1:116043838-116043860 AAATTCAACTTAGGTAAAATGGG + Intronic
913918723 1:124806017-124806039 AAACACGCTTTTGGTAGAATCGG + Intergenic
913919119 1:124810607-124810629 AAACACACTTTTGGTAAAATTGG + Intergenic
919901505 1:202047174-202047196 AAACACATCTTAGGTAAACTTGG - Intergenic
921072587 1:211674838-211674860 AAACACGACTGGGGTGGAATGGG - Intronic
1069363981 10:67676885-67676907 AAACACTTCTAGGGTAACATAGG + Intronic
1074838751 10:117326888-117326910 AAAGGCGACTTGGTTAAAATGGG + Intronic
1075468124 10:122667183-122667205 AGACATGACTTTGGTGAAATAGG + Intergenic
1081451514 11:43175128-43175150 AAACACCACTTGGGTGTAATTGG + Intergenic
1083400013 11:62417023-62417045 AGAGAAGACTTGGGAAAAATAGG - Intronic
1085193342 11:74648518-74648540 AAACAGGTCTTGAGAAAAATAGG + Intronic
1089666052 11:120020187-120020209 AAAAACCACTTTGGCAAAATAGG + Intergenic
1094535817 12:31322527-31322549 AACCAAAACTTGGGAAAAATAGG + Intronic
1094535827 12:31322639-31322661 AACCAAAACTTGGGAAAAATAGG + Intronic
1094857210 12:34411370-34411392 AAACACGGTTTTGGTAGAATCGG - Intergenic
1102563664 12:113780441-113780463 AAACACCAATTAGGTAAAATGGG + Intergenic
1104409500 12:128546501-128546523 AAACACAACTGGGGTCAAAGTGG - Intronic
1104806983 12:131595907-131595929 AAAAATGACTTAGGTAAAACAGG - Intergenic
1106472397 13:30068798-30068820 ACAGGCGACTTGGTTAAAATGGG + Intergenic
1107387879 13:39932118-39932140 ATACAAGACTTTGGTAAAGTTGG + Intergenic
1109104354 13:58231385-58231407 ATACATGACTTGGGTGTAATGGG - Intergenic
1110744256 13:79034430-79034452 AAAGACGACTTGTGCAAAGTTGG + Intergenic
1114939423 14:27589203-27589225 AAAAACTACTTTGGTTAAATTGG + Intergenic
1115663343 14:35519259-35519281 AAAAACAGCCTGGGTAAAATAGG - Intergenic
1116178287 14:41501893-41501915 AAACAAAACTTAGGTATAATAGG + Intergenic
1117215954 14:53552001-53552023 AACCACCACTTGGTTAAAACAGG - Intergenic
1118485398 14:66209968-66209990 AAACACTACTTGGGTCAAAGAGG + Intergenic
1121066731 14:90974158-90974180 AATCACTAATTGGGAAAAATCGG + Intronic
1121400187 14:93669369-93669391 AAACACTCCCTGGGTAAAAATGG - Intronic
1123472955 15:20568436-20568458 AAACACCAGATGGGTAAGATGGG + Intergenic
1123645050 15:22431917-22431939 AAACACCAGATGGGTAAGATGGG - Intergenic
1124283761 15:28384721-28384743 AAACACCAGATGGGTAAGATGGG + Exonic
1124298936 15:28526892-28526914 AAACACCAGATGGGTAAGATGGG - Exonic
1137399357 16:48140807-48140829 AAAGAAGACTTTGGTAAACTCGG + Exonic
1138723686 16:59112098-59112120 AAAGAAGTCTAGGGTAAAATGGG + Intergenic
1144424916 17:15132725-15132747 AAACAGGATGTGGGTGAAATTGG - Intergenic
1145256389 17:21325597-21325619 AAACACAACTTGGGTACCAGGGG + Intergenic
1145320221 17:21762349-21762371 AAACACAACTTGGGTACCAGGGG - Intergenic
1154540504 18:15528845-15528867 AAACACGATTTTTGTAGAATCGG + Intergenic
1154547307 18:15627803-15627825 AAACACGATTTTTGTAGAATCGG + Intergenic
1155311668 18:24530331-24530353 AAACAAGAATTGACTAAAATAGG + Intergenic
1156685447 18:39639876-39639898 AAACACTACTTGGAGAAAAGAGG + Intergenic
1158491532 18:57914125-57914147 AAACAAGAATTGGTAAAAATTGG + Intergenic
1164330863 19:24254148-24254170 AAACACTCTTTTGGTAAAATCGG - Intergenic
1164363694 19:27548749-27548771 AAACACTCTTTTGGTAAAATTGG + Intergenic
926279608 2:11435024-11435046 ATATACGACTTGGATTAAATCGG + Intergenic
926734971 2:16066570-16066592 AAAGACTAATTGGGAAAAATGGG + Intergenic
929343563 2:40853237-40853259 AAACAGGAATTGGCTACAATAGG - Intergenic
935538211 2:104319107-104319129 AAACATTACTTGGTTATAATGGG + Intergenic
938884477 2:135629332-135629354 AAACAAAACTTGGGTGAAAGAGG + Intronic
946842674 2:223834254-223834276 TAATACGACTTGGGCAACATAGG + Intronic
947160459 2:227209097-227209119 AAACATGACTTGAGAAAAAGTGG + Intronic
948792998 2:240388825-240388847 AAACATGACAGGGGTTAAATCGG + Intergenic
1168829531 20:837767-837789 GAACAGGACTTGGGTAGAAGTGG + Intronic
1170849070 20:19987325-19987347 GACCACTACTTGGTTAAAATAGG - Intronic
1174745405 20:53057305-53057327 AAACACAAATTGAGTAAAAGAGG - Intronic
1174963456 20:55184497-55184519 AAACACTTTTTCGGTAAAATAGG + Intergenic
1178130604 21:29568554-29568576 TAAAATGACTTGGATAAAATAGG - Intronic
949296955 3:2535929-2535951 AAACACAGCTTTGGGAAAATGGG - Intronic
955093928 3:55778268-55778290 AAACATGACTTGGGTAAGTCCGG + Intronic
957375292 3:79348497-79348519 AAACACAACTGTGGAAAAATTGG + Intronic
958668196 3:97167727-97167749 AAATATGACTTGGATAAATTAGG - Intronic
959260299 3:104070723-104070745 AAATACAACTAAGGTAAAATTGG + Intergenic
960178960 3:114551806-114551828 AAACACATCTGGGGTACAATTGG - Intronic
962170065 3:133092364-133092386 AAATATGACTTGGGTAAAAGAGG - Intronic
965900900 3:173640615-173640637 AAACACTACTTGGGTCAATTAGG - Intronic
966264036 3:178016080-178016102 AAAGGGGGCTTGGGTAAAATGGG - Intergenic
966364552 3:179170094-179170116 ACACACGACCTTAGTAAAATAGG + Intronic
967803383 3:193689740-193689762 ATACACGATTTGAGTACAATAGG - Intronic
976453263 4:85216940-85216962 AAACAGGACCAGGGCAAAATCGG - Intergenic
978682552 4:111399399-111399421 CATCTCTACTTGGGTAAAATCGG - Intergenic
978985442 4:115006426-115006448 AAACTGGACTTGGGAAAAAAGGG + Intronic
984839545 4:184055488-184055510 AAACAAGAATGGGGAAAAATGGG + Intergenic
986278916 5:6306572-6306594 AAACACGATTTGGGGAAAGGAGG - Intergenic
987781640 5:22444622-22444644 AAACACGACTTGGGTAAAATGGG + Intronic
992751009 5:79860726-79860748 AAAAATTACTTGGGTAAAGTTGG + Intergenic
993090133 5:83415418-83415440 AAACACACCTTGGGAAATATTGG + Intergenic
994777943 5:104059261-104059283 AAATAGGAGCTGGGTAAAATGGG - Intergenic
995785940 5:115827738-115827760 AGACAAGACTTGGGAAAAGTGGG + Intergenic
995873564 5:116767150-116767172 AAAAAAGAATTGGGTAATATGGG + Intergenic
996565055 5:124871154-124871176 AAACAGGACTTAGGTGAAATGGG + Intergenic
1002558985 5:180067828-180067850 AAACAGGATTTGGGTGAAAGGGG - Intronic
1014353627 6:120375949-120375971 AAGCAAGCCTTGGGTAAAACAGG + Intergenic
1014870539 6:126590730-126590752 AAAATCTACTTGTGTAAAATTGG - Intergenic
1015689066 6:135900537-135900559 AAGCAAGAATTGGGTAAAATAGG - Intronic
1021172028 7:17409889-17409911 AATGACAACTTGGATAAAATGGG + Intergenic
1026032076 7:66803025-66803047 AAATAAGAATTGGGTAAGATTGG - Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1042110800 8:65379503-65379525 AAAAATGACTTAGGAAAAATTGG - Intergenic
1043279354 8:78444508-78444530 AATCACGACTTTGTTAAAAGTGG - Intergenic
1052130004 9:24832225-24832247 AAACTCGGGTTGGGTAAACTAGG - Intergenic
1052264800 9:26559504-26559526 AAACACGACTTTTCTAAAATTGG - Intergenic
1052663929 9:31470308-31470330 AAATAGGAGCTGGGTAAAATGGG - Intergenic
1055536130 9:77246997-77247019 AAACTCAATTTGGGTAAAATTGG - Intronic
1057719177 9:97518520-97518542 AAAGAGGAGTTGGGTAAAAGAGG - Intronic
1058481066 9:105395785-105395807 AAAGAAGACTTGGGAATAATTGG + Exonic
1058931414 9:109722989-109723011 AAACGCGAGTTGGGTAGAATTGG - Intronic
1193828267 X:86254064-86254086 AAACAATCCTTGGGTATAATGGG + Intronic
1197629085 X:128837164-128837186 AAACACAAGTTGGGTAGAAGAGG + Intergenic
1197963300 X:132029106-132029128 AAACAGGAATTGGGTATGATAGG + Intergenic
1200238395 X:154480315-154480337 AAAGACCACTTCGGAAAAATTGG - Intergenic