ID: 987783668 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:22470706-22470728 |
| Sequence | ATAGAAAAGAAGACTGGGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2310 | |||
| Summary | {0: 1, 1: 0, 2: 35, 3: 255, 4: 2019} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987783668_987783672 | 12 | Left | 987783668 | 5:22470706-22470728 | CCTTGCCCAGTCTTCTTTTCTAT | 0: 1 1: 0 2: 35 3: 255 4: 2019 |
||
| Right | 987783672 | 5:22470741-22470763 | ATGATAGTCATCAGATTAATTGG | 0: 1 1: 0 2: 1 3: 10 4: 160 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987783668 | Original CRISPR | ATAGAAAAGAAGACTGGGCA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||