ID: 987783668

View in Genome Browser
Species Human (GRCh38)
Location 5:22470706-22470728
Sequence ATAGAAAAGAAGACTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2310
Summary {0: 1, 1: 0, 2: 35, 3: 255, 4: 2019}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987783668_987783672 12 Left 987783668 5:22470706-22470728 CCTTGCCCAGTCTTCTTTTCTAT 0: 1
1: 0
2: 35
3: 255
4: 2019
Right 987783672 5:22470741-22470763 ATGATAGTCATCAGATTAATTGG 0: 1
1: 0
2: 1
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987783668 Original CRISPR ATAGAAAAGAAGACTGGGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr