ID: 987785053

View in Genome Browser
Species Human (GRCh38)
Location 5:22488828-22488850
Sequence AGTATTGGCCAGTAGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987785053_987785060 9 Left 987785053 5:22488828-22488850 CCCTCTATCTACTGGCCAATACT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 987785060 5:22488860-22488882 CTATGTTGTCCCATGTGGCATGG 0: 1
1: 0
2: 0
3: 18
4: 163
987785053_987785057 4 Left 987785053 5:22488828-22488850 CCCTCTATCTACTGGCCAATACT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 987785057 5:22488855-22488877 CTTCCCTATGTTGTCCCATGTGG 0: 1
1: 0
2: 1
3: 23
4: 190
987785053_987785061 14 Left 987785053 5:22488828-22488850 CCCTCTATCTACTGGCCAATACT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 987785061 5:22488865-22488887 TTGTCCCATGTGGCATGGCATGG 0: 1
1: 0
2: 0
3: 19
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987785053 Original CRISPR AGTATTGGCCAGTAGATAGA GGG (reversed) Intronic
910765895 1:90781867-90781889 AGTATTTGCCAATGGATAGAAGG + Intergenic
911631371 1:100186957-100186979 GGAATTGGCCAGAAGTTAGAAGG + Exonic
911774628 1:101792534-101792556 AGTACTAGCCAGTTAATAGATGG + Intergenic
912688184 1:111783478-111783500 AGTATTGGCTTGAACATAGATGG - Intronic
913076275 1:115343041-115343063 AGTAGTCCCCAGTAGATACATGG + Intergenic
916403265 1:164471580-164471602 AGTATTGGCCTGTATACAGCAGG + Intergenic
916891830 1:169119530-169119552 AGAAGTGGGCAGTAGAAAGAGGG + Intronic
919135448 1:193502262-193502284 AGAATTGGCAAGCAGATACAAGG + Intergenic
919541188 1:198847245-198847267 ATTATTGCCCAGAAGAGAGATGG - Intergenic
920630988 1:207651350-207651372 AATATTGGACAGTATATATATGG + Intronic
921936536 1:220801525-220801547 AGTATTGTCCAGGAGAAAGGGGG + Intronic
924658931 1:245998434-245998456 AATATTGGCTAGTAAATAAAAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1066198066 10:33120955-33120977 TGTAGTTGCCAGAAGATAGAGGG - Intergenic
1070729172 10:78813520-78813542 AGGATTGGCAAGTAGAGAGCTGG - Intergenic
1071464235 10:85925126-85925148 AGTATTGGCCAATGGATACTTGG + Intronic
1071556097 10:86602841-86602863 AGTAATTGCCAGGGGATAGAGGG + Intergenic
1074477755 10:113788193-113788215 AATATTGCCCGGCAGATAGAAGG - Intergenic
1076495625 10:130895810-130895832 AGTATTGGCAAGGAGAGAAATGG + Intergenic
1084527790 11:69707610-69707632 AATATTGGTCACTTGATAGATGG - Intergenic
1086005994 11:82036545-82036567 AGCATTGCACAGTAGAAAGAGGG + Intergenic
1086539403 11:87890029-87890051 AGTAGTGTCCTGTACATAGAAGG - Intergenic
1090072184 11:123553546-123553568 AGAAATGGCCAGGAGATTGAAGG - Intronic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1092397335 12:8139284-8139306 AGTATTGGCCAATGGATGAAAGG - Intronic
1098896518 12:76068784-76068806 AGTATGGACCAGTAGATAAATGG + Intronic
1099829256 12:87818804-87818826 AGTATTCTCCAGAAGAGAGATGG - Intergenic
1101746167 12:107543583-107543605 AGTGTTGGCCACAACATAGAGGG + Intronic
1105939685 13:25136535-25136557 AATATTTCCCAGTAGATAAAAGG - Intergenic
1107385439 13:39903419-39903441 AATATTATCCAGTACATAGAAGG + Intergenic
1110269086 13:73572986-73573008 AGTAGTGGCTAGGGGATAGAAGG - Intergenic
1112605568 13:100902209-100902231 AGTATTTGACAGTACAAAGAAGG - Intergenic
1113350668 13:109526137-109526159 ATTTCTGGCCAGGAGATAGAAGG - Intergenic
1114881744 14:26794961-26794983 AATCTTGGCAAGTAGCTAGAAGG + Intergenic
1116684720 14:48023916-48023938 AATATTGGGCACTAGAAAGAAGG + Intergenic
1120232463 14:81855276-81855298 AGGACTGAGCAGTAGATAGAGGG + Intergenic
1123131989 14:105994546-105994568 AGGAGAGGCCAGTAGATGGAGGG + Intergenic
1123582225 15:21725676-21725698 AGGAGAGGCCAGTAGATGGAGGG + Intergenic
1123618875 15:22168272-22168294 AGGAGAGGCCAGTAGATGGAGGG + Intergenic
1127016192 15:54691188-54691210 TGTGTTTGCCAGTAGATATATGG - Intergenic
1127531712 15:59850061-59850083 GCTCTTGGCCAGTAGATAGATGG + Intergenic
1135133038 16:19868465-19868487 AGTTTGGGCCAGCAGAGAGATGG + Intronic
1135715286 16:24759573-24759595 AATATAGGCCTGGAGATAGAGGG + Intronic
1135793213 16:25417546-25417568 AGAATTGATAAGTAGATAGATGG - Intergenic
1137918267 16:52456436-52456458 CATATAGGCCAATAGATAGAAGG - Intronic
1138728354 16:59165809-59165831 TTTATTGGCCAGTATATAGCAGG - Intergenic
1138772289 16:59680327-59680349 AGTACTGGCCAGCTGGTAGATGG - Intergenic
1145053571 17:19682946-19682968 ATTATTGGCCAATAGATATTTGG + Intronic
1146978103 17:37133317-37133339 AGTATGCGCCAGTAGAATGAGGG + Intronic
1150673039 17:67218687-67218709 AGTACTGGCCAAGAGAAAGAAGG + Exonic
1151985255 17:77538973-77538995 AGTATTGCCAAAGAGATAGAGGG - Intergenic
1153263331 18:3245261-3245283 AGTATTGGTCAAAAGATTGAGGG + Intergenic
1153943434 18:9996526-9996548 AGTATTGGGCTGTCAATAGAAGG + Intergenic
1156552901 18:38036957-38036979 AGTTTGGTGCAGTAGATAGATGG - Intergenic
1164342640 19:24422807-24422829 AGAATTTGCCAGTAGATATTTGG + Intergenic
1164342830 19:24425703-24425725 AGAATTTGCCAGTAGATATTTGG + Intergenic
1164343020 19:24428599-24428621 AGAATTTGCCAGTAGATATTTGG + Intergenic
925735601 2:6960579-6960601 AGTATTGGTGTGTAGAGAGAAGG + Intronic
927497519 2:23560924-23560946 ATTGTTGGCCAGTGGACAGACGG - Intronic
928915604 2:36466801-36466823 AGTGTAGGGCAGTAAATAGATGG - Intronic
935317946 2:101855840-101855862 ATAATTGGCCAGTAGATATGGGG + Intronic
938993606 2:136654759-136654781 TCCTTTGGCCAGTAGATAGAAGG - Intergenic
941525411 2:166600639-166600661 ATTAATGGCCAGTATATAGAAGG + Intergenic
944106203 2:196082360-196082382 AGTTTTGGACAGTAATTAGAGGG - Intergenic
945824541 2:214704972-214704994 AGTAATGACCAATAGATAGGTGG + Intergenic
947780306 2:232754261-232754283 AGGATTGGCTAATACATAGATGG + Intronic
1169416962 20:5425636-5425658 AGAATGGGACAGTAGAAAGATGG + Intergenic
1170930052 20:20761523-20761545 AGTGTTGCCTAATAGATAGAGGG - Intergenic
1171729398 20:28669144-28669166 AGAATTGGCCAGTGGATATTTGG + Intergenic
1171731875 20:28714467-28714489 AGAATTGGCCAGTGGATATTTGG + Intergenic
1171732209 20:28720619-28720641 AGAATTGGCCAGTGGATATTTGG + Intergenic
1172455061 20:35064246-35064268 AGTATTGGCCTATAGCTAGAAGG - Intronic
1176475730 21:7203362-7203384 AGAATTGGCCAGTGGATATTTGG - Intergenic
1177397763 21:20559791-20559813 AAAATTGGCCAGGAGCTAGAGGG + Intergenic
1178253103 21:31023447-31023469 AGCATTGGCCAGGAGGCAGAGGG - Intergenic
953014492 3:39060240-39060262 AGTAATTGCCAGGAGATTGAAGG - Intronic
954130804 3:48559852-48559874 AGGACTGGCCAGTAGATACAGGG - Intronic
960430630 3:117564290-117564312 AGTATTGGCCTGTAGGAAAAAGG - Intergenic
961944768 3:130674183-130674205 TGTATTGGCCAGTACAAAAAAGG - Intronic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
967058679 3:185852173-185852195 TGCATTGGCCAATAGATTGAGGG + Intergenic
972309541 4:37867149-37867171 AGAATTGCCCAGTGGAAAGATGG - Intergenic
974255645 4:59450953-59450975 AGTTTTCACCAGTAGAAAGAGGG - Intergenic
974914421 4:68162197-68162219 AGTGTTAGCCAGCACATAGATGG - Intergenic
978339083 4:107702739-107702761 AGTGTTGACCAGTTGATAAATGG - Intronic
979414961 4:120425667-120425689 AGTATGGGCCAGAAGAGAGGGGG + Intergenic
981243980 4:142513148-142513170 AATAGTGTCCAGTACATAGAAGG - Intronic
983138149 4:164111358-164111380 AATATTGCCCAGTAGATACAAGG + Intronic
986257276 5:6110827-6110849 AGTTTTGGCCAGGAGTCAGAGGG - Intergenic
987785053 5:22488828-22488850 AGTATTGGCCAGTAGATAGAGGG - Intronic
988932746 5:36052915-36052937 AGTATTTGCCAGTAGATACTTGG - Intronic
989866970 5:46525460-46525482 AGTATTTGCAAGTGGATATATGG + Intergenic
989871171 5:46600813-46600835 AGTATTTGCAAGTGGATATATGG + Intergenic
991571623 5:68060530-68060552 AGGATTTGCCAGAAGAGAGAAGG - Intergenic
995159338 5:108959550-108959572 AGTATTTGCTAGTATACAGATGG + Intronic
996944754 5:129053632-129053654 AATGTGGGCCAGTAGACAGATGG - Intergenic
997125574 5:131223743-131223765 AAAATTGGGCAGTAGATAGAGGG - Intergenic
998383709 5:141743784-141743806 AGGATTGGCCATTTGATAAATGG + Intergenic
1003462643 6:6345417-6345439 TGTATTTGCCAGTAGAGACAGGG + Intergenic
1003628019 6:7761363-7761385 ATAATTGGGCAGTAGACAGAAGG + Intronic
1003692374 6:8367216-8367238 ATGATTGGCCAGAAGACAGATGG - Intergenic
1006911269 6:37565190-37565212 AGGATTGGCCAGTGGTTGGAGGG - Intergenic
1008165006 6:48126074-48126096 ACTATTGGCAAGGAGAGAGAGGG + Intergenic
1011856876 6:91703970-91703992 AGTATTAGCCAATATATATATGG + Intergenic
1015547247 6:134374156-134374178 AATAGTAGCCAGGAGATAGAAGG + Intergenic
1020510629 7:9052529-9052551 GGTATTCACCAGTAGAGAGAAGG - Intergenic
1021089186 7:16462190-16462212 GGGATGGGCCAGTAGATGGAGGG + Exonic
1022025416 7:26443867-26443889 GGTATTTGCCTGTAGATAAATGG + Intergenic
1022772527 7:33489364-33489386 AGTTTTCTCCAGTAGGTAGAAGG + Intronic
1028482717 7:91325299-91325321 AGAGTTGGCCAGGAGATGGATGG - Intergenic
1029251483 7:99239824-99239846 AGTGTGGGCCAGCAGAGAGAAGG - Intergenic
1029334990 7:99891242-99891264 AGTATTGGCCAGCTGGTAAATGG - Exonic
1030861774 7:114640536-114640558 AGTATTGGCCAGTAGCCAATAGG - Intronic
1031516340 7:122703538-122703560 AGTATTTGCCAGCACATAGTAGG - Intronic
1031925218 7:127632467-127632489 AGTTTTGGCCAGAAGAAACATGG - Intergenic
1037156910 8:15712627-15712649 GGGATTGGCAAGAAGATAGACGG - Intronic
1038621967 8:29152748-29152770 ATTATTGGCTAGTAGAGACAGGG + Intronic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1039689845 8:39851684-39851706 AATTTTGGCCAGAAGATTGAGGG + Intergenic
1040143201 8:43952470-43952492 AGTATTTGCCAGTGGATAATTGG + Intergenic
1040271905 8:45959698-45959720 AGTATTTGCCAGTGGATAATTGG + Intergenic
1041138519 8:54788347-54788369 ACTATTAGCCATTAGCTAGATGG + Intergenic
1043144092 8:76629910-76629932 ATTAATGGCCAGAATATAGAAGG + Intergenic
1047945592 8:129875734-129875756 AGTAAAGGACAGTAGAAAGAAGG - Intronic
1048873067 8:138814660-138814682 AGCATTGGCCAGCAGCTTGAGGG + Intronic
1052290893 9:26839433-26839455 AGTTTTGGCCAAAAGATATAAGG + Intergenic
1052953449 9:34232520-34232542 AGTTCTGGCCAGAAGTTAGATGG + Intronic
1054973853 9:71120317-71120339 ATTTTTGCCCAGTAAATAGAAGG - Intronic
1055676531 9:78668184-78668206 AATATATGCCATTAGATAGATGG + Intergenic
1056388573 9:86119461-86119483 AGGATTGGTCAGGAGACAGAGGG + Intergenic
1057832524 9:98418088-98418110 GGTGTTGGCCAGGAGATAGCAGG + Intronic
1059978656 9:119745179-119745201 AATATAGGCCATAAGATAGATGG + Intergenic
1061784162 9:133015301-133015323 ATTATTGGCCAGTATATTGTTGG - Intergenic
1203411163 Un_KI270579v1:6051-6073 AGAATTGGCCAGTGGATATTTGG - Intergenic
1187004419 X:15217986-15218008 ATTAATGGACAGTAGATGGATGG + Intergenic
1187756962 X:22538856-22538878 AGCATTGGCAAGAAGCTAGAAGG + Intergenic
1192480639 X:71482221-71482243 AGTATTGGCCATGAGATAAAGGG - Intronic