ID: 987793077

View in Genome Browser
Species Human (GRCh38)
Location 5:22593408-22593430
Sequence CAGGGAAAACAGGAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1239
Summary {0: 1, 1: 0, 2: 8, 3: 137, 4: 1093}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987793077 Original CRISPR CAGGGAAAACAGGAGAAAGA AGG (reversed) Intronic
900469064 1:2842808-2842830 AAGGGAAAACAGGAAAAAAGTGG - Intergenic
900510057 1:3054563-3054585 CAGAGAAGACAGGTCAAAGAGGG + Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901379012 1:8860564-8860586 TGGGGAAAGCAGGTGAAAGAAGG - Intergenic
901394813 1:8973341-8973363 TAGGGAAAGCAGGGGAAATATGG - Intronic
901545123 1:9950548-9950570 CAGGAAAAACAGGACCCAGATGG + Intronic
901748481 1:11390507-11390529 AGGGGAAGAGAGGAGAAAGAAGG + Intergenic
901755969 1:11441788-11441810 AAGGGAGGAGAGGAGAAAGAGGG + Intergenic
901959045 1:12810194-12810216 CAGGGAAACCTGGGGAGAGAGGG - Intergenic
902959369 1:19951629-19951651 CAGAGAAAAAATGAAAAAGAAGG + Intergenic
903141673 1:21342951-21342973 CAGGAAACAAAAGAGAAAGAGGG - Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904197011 1:28793386-28793408 AAGGGAAAACTGGAGAACTAGGG + Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904632869 1:31856133-31856155 CAGAGAAAGACGGAGAAAGAGGG + Intergenic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904848400 1:33438416-33438438 CAGGGAAGGCAGGAGACAGAAGG - Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904996618 1:34636435-34636457 CAGAGAAAACAGTAGAGACACGG + Intergenic
905060918 1:35138293-35138315 TAGGCAAAACAGAAGAAAAAGGG - Intergenic
905310108 1:37043157-37043179 CAGGGAAGAGAGGAGCATGAAGG + Intergenic
905446511 1:38031238-38031260 CAGAGGGAACATGAGAAAGAGGG + Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906086977 1:43144542-43144564 GAGGAAAAACAGCAGAAAGGAGG - Intergenic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906343811 1:45003122-45003144 GAGAGAAAATAGGAGAAAAAAGG + Exonic
906395357 1:45458889-45458911 CATGGAAAAAAGTAGAAAGAGGG - Intronic
906962937 1:50430453-50430475 GATGGAAACCAGGAGAAGGATGG - Intergenic
907229948 1:52987600-52987622 ATGGAAAAACAGGAGAAAAAAGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907908642 1:58808116-58808138 CAGGTAAAATAGGACAAAGCTGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908010494 1:59771635-59771657 CATGGAATACAGGATAGAGAAGG - Intergenic
908021214 1:59900888-59900910 AAGGGAAAACAGGAGAGAGCAGG + Intronic
908123127 1:61004547-61004569 CAAGGCAAAAGGGAGAAAGAGGG + Intronic
908256903 1:62310383-62310405 CAGGGAGGACTGGAGAGAGAGGG + Intronic
908633710 1:66138797-66138819 AAGGGAAAACACTTGAAAGAAGG - Intronic
908876930 1:68687635-68687657 AAGGGAAAGAAAGAGAAAGAAGG - Intergenic
908951629 1:69568476-69568498 TAGGAAGAACAGGAGATAGAGGG - Intronic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909800821 1:79805717-79805739 CAAGGAAGAAAGGAGAAAGCAGG - Intergenic
910219801 1:84878843-84878865 CAAGGAAAACACCAGAGAGAGGG - Intronic
911012121 1:93291329-93291351 CAGTGAAAACAGTACTAAGAGGG + Intergenic
911031741 1:93496243-93496265 AAGGAAAAAGAGGAGAAGGAAGG - Intronic
911145019 1:94542911-94542933 CTGGGAAAACGTGGGAAAGAAGG - Intergenic
911154675 1:94626091-94626113 TAGGGAAAGAAGGAGAAAGAGGG + Intergenic
911525499 1:98980010-98980032 CAGGAAAACCAAGATAAAGATGG - Intronic
911574266 1:99556301-99556323 CAGGTAAAATAGGAGTAAAATGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
911961425 1:104307929-104307951 GTGGGAAAATAGGAGACAGATGG + Intergenic
912116734 1:106416726-106416748 GAGAGAAAACAGGTTAAAGAAGG + Intergenic
912581262 1:110723016-110723038 CAGGGAAGAAATGAGTAAGAAGG - Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913595846 1:120375877-120375899 GAGGGAAAGAAGGAGAGAGAGGG + Intergenic
914091431 1:144503099-144503121 GAGGGAAAGAAGGAGAGAGAGGG - Intergenic
914307171 1:146431090-146431112 GAGGGAAAGAAGGAGAGAGAGGG + Intergenic
914594935 1:149142031-149142053 GAGGGAAAGAAGGAGAGAGAGGG - Intergenic
914695766 1:150078054-150078076 CATGGAAATGAGGAGACAGAAGG - Intronic
914764683 1:150627573-150627595 CAGGACACGCAGGAGAAAGAAGG - Exonic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
915123106 1:153644930-153644952 CAGGGCAAAGAGGAGAAATCTGG - Intronic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915437700 1:155921314-155921336 TAGGAAAAACTGGGGAAAGAGGG - Intronic
915463278 1:156082054-156082076 AAGGGAAAAGAGGAGAGAGGAGG + Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916204068 1:162298280-162298302 CATGGGAAACGGGAGCAAGAAGG - Intronic
916274809 1:162982241-162982263 CAGGGCAAATAGGAGAGACATGG + Intergenic
916481676 1:165219998-165220020 CAGGGAGAAAAGGGGAGAGAGGG + Intronic
916702377 1:167311025-167311047 CTGGGAAGAGAGGAGAAAGAGGG + Intronic
916841474 1:168605839-168605861 CAGGCAAAAAATGAGAAAGCTGG - Intergenic
916911127 1:169347592-169347614 GAGGGAGCACAGGAGAGAGAAGG - Intronic
916985718 1:170189628-170189650 AATGGAAAACAGGAAAAAGCAGG - Intergenic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
917095035 1:171391404-171391426 GAGGGAAATAAGGATAAAGATGG - Intergenic
917459719 1:175219472-175219494 GAGGGAACACAGGATAAAGTAGG - Intergenic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
917619178 1:176778288-176778310 CAAGGAAAATAGGGGAAAGAGGG + Intronic
917923689 1:179771438-179771460 GAGACAAAACAGGAAAAAGAGGG - Intronic
918006878 1:180549423-180549445 CAGGGAAAATAGGAAAGAGAGGG + Intergenic
918187469 1:182141078-182141100 CAGGGAAAACAGCACAGAGAAGG + Intergenic
918363568 1:183783602-183783624 AAGGGAAATAAGGAGAAAGGGGG - Intronic
918480009 1:184968497-184968519 TGGAGGAAACAGGAGAAAGAGGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918878191 1:190078665-190078687 CAGGAAATACAGGAGAAATATGG + Intergenic
918982697 1:191584217-191584239 CATGGAAAACAGGAAAAAGCAGG - Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919700903 1:200629997-200630019 CGGGTAAAAAAAGAGAAAGATGG - Intronic
920011188 1:202868911-202868933 CAGGGAAAACAAAAAAAAGCTGG - Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920092942 1:203467039-203467061 AATGGAGAACAGGAGAAAGAAGG + Intergenic
920364309 1:205440087-205440109 CAGGGGAGACAGGAGAATCAAGG + Intronic
920441254 1:205982195-205982217 CGGGGAACAAAGGAGAAAGCAGG - Intronic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920552146 1:206871175-206871197 AAGGGAAAACTGCACAAAGATGG + Intergenic
921295540 1:213697805-213697827 CAGGTAATAGAGGAGAAAAATGG - Intergenic
921326317 1:213988879-213988901 AAGAGAGAGCAGGAGAAAGAAGG - Intronic
921364865 1:214364284-214364306 CAGATAAAACAGGAGAAATGAGG - Intronic
921628980 1:217411053-217411075 CAGAGGCAAAAGGAGAAAGAGGG - Intergenic
922072119 1:222204832-222204854 CATGGAAAATAGAAGACAGAAGG + Intergenic
922344315 1:224683680-224683702 AAGGGAAAACATGAGAAACGAGG - Intronic
923127851 1:231047672-231047694 GAGGGAGAAAGGGAGAAAGAAGG - Intergenic
923492324 1:234494958-234494980 GAGGGGAAACTGGAGACAGAGGG + Intergenic
923504532 1:234594097-234594119 AAGGTAAAGCAGGAGAAAGTAGG - Intergenic
923515742 1:234696467-234696489 CATGGAAACCAGTTGAAAGAGGG - Intergenic
923986321 1:239386739-239386761 AAGGGAATACACGATAAAGAAGG + Intronic
924408528 1:243777900-243777922 CAGGGAGAAAAGGAAAAACAGGG - Intronic
924526448 1:244855495-244855517 CAGGAAAAACAGGGGCACGAGGG + Exonic
924629797 1:245726000-245726022 AATGGAAAACAGGAAAAAGCAGG + Intergenic
924703160 1:246474728-246474750 AAGGGGAGACAGGAGACAGAGGG + Intronic
924863262 1:247949465-247949487 GAAGGGAAACACGAGAAAGATGG - Exonic
924865521 1:247975329-247975351 AAAGGTAAACATGAGAAAGAGGG - Intronic
924867721 1:248003738-248003760 GAAGGGAAACACGAGAAAGATGG - Intronic
924872259 1:248061289-248061311 GAAGGGAAACACGAGAAAGATGG - Exonic
1062813632 10:483558-483580 TGAGGAAAACAGGAGAAGGACGG - Intronic
1062958326 10:1554580-1554602 TGGGGAAAGCAGGAGAATGAAGG - Intronic
1063006595 10:1977458-1977480 CAGGGCATACAGTATAAAGACGG - Intergenic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1063692754 10:8302847-8302869 TATGGAAAATAGGAAAAAGAGGG + Intergenic
1064234654 10:13563081-13563103 GAGAGAAAGCAGGAGAGAGAAGG + Intergenic
1065111721 10:22446409-22446431 GAGGGAAAAAAAGAGAGAGATGG + Intronic
1065427820 10:25623675-25623697 CAGGGCAATCAGGCAAAAGAAGG + Intergenic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1066056430 10:31685383-31685405 CAGGGAAATGAGGATAGAGAAGG - Intergenic
1066144237 10:32540344-32540366 CATGGAAAACAGGAAAAAGCAGG - Intronic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067766704 10:49092476-49092498 TAGGGAAAACAAGAGTAATAAGG + Intronic
1068199656 10:53766575-53766597 CAGGGAAAAAAGAAGTAATATGG + Intergenic
1068262456 10:54600246-54600268 CAGGAGAAAGAGGAGAAAGTGGG + Intronic
1068617260 10:59132808-59132830 CAGGGAGAACAGGGCACAGAGGG + Intergenic
1069025095 10:63531135-63531157 CAGGGAAAACAGTAGCAATCAGG + Intronic
1069167475 10:65180483-65180505 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1069228389 10:65973727-65973749 TGGGGAGAACAGGAGCAAGAGGG + Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1069935571 10:71913432-71913454 GAGGGAAAACTGGAGAAACATGG + Intergenic
1069957443 10:72060693-72060715 GAGAGAGGACAGGAGAAAGAGGG + Exonic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070343970 10:75523783-75523805 CAGGGAAGAAGGGAGAAGGATGG - Intronic
1070367996 10:75754725-75754747 CGGGGAAAAGGGGAGAAAGAAGG - Intronic
1070402595 10:76066634-76066656 CAGGAAGATCAGGAGATAGAAGG + Intronic
1070694984 10:78555997-78556019 GAAGGAAAACAGGGCAAAGATGG - Intergenic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071305200 10:84293530-84293552 CAGGGACAACAGGGCAGAGAAGG - Intergenic
1071333934 10:84586555-84586577 CAAGGATAAGAGGAGAAGGAGGG - Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071542092 10:86495012-86495034 CAGGTAAAATAGGAAAAATAAGG + Intronic
1071584013 10:86801691-86801713 CAGGTTAAACAGTTGAAAGAAGG - Intronic
1071680118 10:87696304-87696326 AATAGAAAAGAGGAGAAAGAAGG - Intronic
1071745874 10:88418974-88418996 AAGAGAGAACAGGAGAAAGTAGG - Intronic
1071896793 10:90076424-90076446 GAAGGAGTACAGGAGAAAGAAGG + Intergenic
1071935921 10:90530579-90530601 GAGGGAAAACAGGAAACAAATGG - Intergenic
1072095105 10:92170629-92170651 GAAGGAAAAAAAGAGAAAGATGG + Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072532696 10:96334464-96334486 CTGGGAAAACAGGAGAAACAGGG - Intronic
1072548634 10:96459826-96459848 CAGGGAAAATATGAAATAGATGG + Intronic
1072578372 10:96720244-96720266 CATAGAAAAGAGCAGAAAGAGGG + Intronic
1072688956 10:97557666-97557688 CAGCTAGAACAGAAGAAAGAGGG - Intronic
1073114342 10:101082846-101082868 CAGGGAGGACAAGAGAAAAATGG - Intergenic
1073134306 10:101211621-101211643 AAGGGAAAGAAGGAGAAAGAAGG + Intergenic
1073247436 10:102101507-102101529 TAAGGAAAACAAGAGAATGATGG + Intergenic
1073782815 10:106858022-106858044 CAGGGAATCCAGGAAAGAGAGGG - Intronic
1074809650 10:117090850-117090872 CAGGAAAAAGAGGATAGAGAAGG + Intronic
1074872925 10:117591310-117591332 CAGAGAAGACAAGGGAAAGAAGG - Intergenic
1075611735 10:123860042-123860064 CTGGGCAAGCAGGAGAAACAAGG + Intronic
1076113789 10:127881308-127881330 GAAGGAAAACATGAGAAACAGGG - Intronic
1076984525 11:225719-225741 CAGGAACAGCAGGAGAGAGAAGG + Intronic
1077432327 11:2522021-2522043 CCGGGAACACAGGAGAATGCAGG - Intronic
1077765351 11:5153445-5153467 CAGGGAAGACAGGACAAACTTGG + Intronic
1077965686 11:7130363-7130385 CCAGGAAGAAAGGAGAAAGAGGG - Intergenic
1078048026 11:7935797-7935819 AAGTGAAAAAAAGAGAAAGAGGG - Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078636466 11:13054892-13054914 CAGGAATAGCAGGAGATAGAAGG - Intergenic
1078744532 11:14098712-14098734 GAGGGAGAAGAGGAGAGAGAGGG + Intronic
1078765149 11:14289307-14289329 AAGGTAAGCCAGGAGAAAGATGG + Intronic
1078867365 11:15310531-15310553 AGAGGAAAACAGGAGAGAGAGGG - Intergenic
1079073169 11:17365946-17365968 CTCAGAAAACTGGAGAAAGAAGG - Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079253110 11:18802129-18802151 CACTGAAAAGAGGGGAAAGAGGG - Intergenic
1079339094 11:19597437-19597459 CAGGGAAGTCAGTAGTAAGATGG - Intronic
1079567933 11:21905698-21905720 CAAGGAGAACATCAGAAAGAGGG - Intergenic
1079585250 11:22118301-22118323 CATGGAACATAGGAGAATGAAGG - Intergenic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080122446 11:28693236-28693258 GTGGTAAAGCAGGAGAAAGAAGG - Intergenic
1080230522 11:30014651-30014673 CAGGAATAACAGGTGACAGAGGG - Intronic
1080721731 11:34855814-34855836 CAGGGAAATAAGGAGCAAAATGG - Intronic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082741870 11:56919718-56919740 CAGGGCAATCAAGCGAAAGAAGG + Intergenic
1082752821 11:57039003-57039025 CAGGGAAACTAGGGAAAAGATGG - Intergenic
1082909859 11:58358977-58358999 GAGGGTAAACATGATAAAGAGGG + Exonic
1082942961 11:58727426-58727448 CAGAGAAAACAGGAGATACAGGG + Intronic
1083015437 11:59448255-59448277 CCAGGAAAACAGGAGGAAAAGGG + Intergenic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084368925 11:68725000-68725022 AAGGGAAAAGAGTACAAAGATGG + Intronic
1084567978 11:69942407-69942429 CAGGGAAAACCGGCGAAGGGGGG + Intergenic
1085008345 11:73115589-73115611 GAGAGAAAACACGAGAGAGAAGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1086002384 11:81998684-81998706 CAGCTAAATAAGGAGAAAGAGGG - Intergenic
1086280130 11:85175610-85175632 CAGGGCAAACAGGCAACAGAAGG + Intronic
1086542695 11:87931895-87931917 CAGGGAGTAAAGGAGAAAGGAGG + Intergenic
1086566580 11:88233665-88233687 TATGGAAAAGAAGAGAAAGAAGG - Intergenic
1087127666 11:94642816-94642838 CAGAGAAAACAGTAGAGACACGG - Intergenic
1087328461 11:96751890-96751912 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088365780 11:109038565-109038587 CAGGGGAAAAAGGAAAAACATGG - Intergenic
1088726532 11:112642084-112642106 AAGAGAAAGGAGGAGAAAGAAGG - Intergenic
1088829354 11:113522179-113522201 TGGGGAAAACAAGAGTAAGAAGG - Intergenic
1089256606 11:117197559-117197581 CAGGAAAAACGGGAGAATCAAGG - Intergenic
1089759879 11:120715556-120715578 GAGGGGAAAGAGGAGAGAGAGGG - Intronic
1089761848 11:120732519-120732541 CAGTGAAAACAGTACTAAGAGGG - Intronic
1089857337 11:121557758-121557780 CTGGGAAGGCAGGGGAAAGATGG - Intronic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090582759 11:128178079-128178101 CTTGGAAAACAGGGGCAAGATGG - Intergenic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090775721 11:129963615-129963637 GAGGGAAAGAAAGAGAAAGAGGG - Intronic
1091012182 11:132012158-132012180 CGGGGAAGAAAGGAAAAAGAGGG + Intronic
1091056858 11:132427566-132427588 TAAGGAGAACAGAAGAAAGATGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1202828238 11_KI270721v1_random:100275-100297 CGGAGAGAACAGGAGAAAGTGGG + Intergenic
1091436297 12:475635-475657 CAGGGAAGAGATGAGAGAGAAGG - Intronic
1091483906 12:865144-865166 CAGAGGCAACAGCAGAAAGATGG - Intronic
1091776875 12:3190420-3190442 CCTGGAAAACAGGAGAAAGAAGG - Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092064117 12:5575377-5575399 CAGAGAGAGCAGGAGACAGAGGG + Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092556294 12:9565753-9565775 GAAGGAAAACAGGAGAAATGGGG + Intergenic
1092729789 12:11519629-11519651 AGGGGAAAACTGGAGAGAGAAGG - Intergenic
1092858707 12:12699661-12699683 GAGGGGAAAAGGGAGAAAGAAGG + Intergenic
1093046458 12:14451517-14451539 CAGTGAAAACAGTGGTAAGAAGG - Intronic
1093516997 12:19999559-19999581 CAAGCAAAACAAGAGTAAGATGG + Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093765913 12:22962422-22962444 AAGGGAAAAAAAGAAAAAGAAGG - Intergenic
1093802038 12:23385528-23385550 CAGGGAAAGGAGGGGAAAAAAGG + Intergenic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094331941 12:29303381-29303403 CAAGGAGAGCAGGAGAAAGAGGG - Intronic
1094515798 12:31124899-31124921 GAAGGAAAACAGGAGAAATGGGG - Intergenic
1094715328 12:33008217-33008239 GAGAGAAAAGAAGAGAAAGAAGG - Intergenic
1095392256 12:41721727-41721749 ATGGGAGCACAGGAGAAAGAAGG - Intergenic
1095411340 12:41928032-41928054 CAGGGAGAACAGGACAAACAGGG + Intergenic
1095513489 12:42979581-42979603 AAAGGAAAACATGAGAAAGTGGG + Intergenic
1096560954 12:52435540-52435562 CAAGGTTAACAGGAGAAACAGGG - Intergenic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096993294 12:55822190-55822212 GAGGTAAAACAGAAGAAATAAGG + Intronic
1097055004 12:56243877-56243899 CTTGGAAAAAAGGAAAAAGAAGG + Intronic
1097080861 12:56429846-56429868 AAGGGAGAACAGGAGAGAGTTGG - Intronic
1097133902 12:56835667-56835689 AAAGGAAAAAAGGAAAAAGAAGG + Intergenic
1097242368 12:57584195-57584217 CTGGGAAAGAAAGAGAAAGAGGG - Intronic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1097973290 12:65657962-65657984 CAGAGAAAAGAGGAGAACCAAGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098285492 12:68903261-68903283 GGGGGAAAAAAAGAGAAAGATGG - Intronic
1098635944 12:72783678-72783700 CATGGACAACAACAGAAAGAAGG + Intergenic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099951042 12:89304049-89304071 AAGGGAAATTAGGAGAAATAAGG + Intergenic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100213316 12:92420974-92420996 GAGAGAGATCAGGAGAAAGATGG - Intronic
1100442745 12:94631477-94631499 ATGTGAAGACAGGAGAAAGACGG + Intronic
1100465186 12:94838078-94838100 AAAGGAAAAAAGAAGAAAGATGG + Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100931139 12:99610583-99610605 AATGGGAAGCAGGAGAAAGAAGG + Intronic
1101124643 12:101619309-101619331 AAGAGAAATCAGGAGAAAGAAGG - Intronic
1101677978 12:106937084-106937106 AAGGGGAAACAGTAGAGAGAAGG - Intergenic
1102507684 12:113394051-113394073 TGGGGGAAACAGGAGAGAGATGG + Intronic
1102564528 12:113786910-113786932 CAGGGAAAACTAGGGACAGAAGG - Intergenic
1102680793 12:114689029-114689051 CAGAAAAAATAGGATAAAGAAGG - Intergenic
1102788054 12:115620163-115620185 CTGGGAAAAGAGGAGAACCAAGG + Intergenic
1103204317 12:119116457-119116479 AAGGGAGAACAGCAGACAGAAGG + Intronic
1103250166 12:119493007-119493029 CAGGGAAAAAAGGCTACAGAAGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104467455 12:129002534-129002556 CTGAAAGAACAGGAGAAAGAGGG - Intergenic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104747688 12:131220315-131220337 CAGGGAGCACAGGAGTGAGAGGG - Intergenic
1104861854 12:131928193-131928215 AAGGGAAAGCAGGAGACAGGAGG + Intergenic
1105357996 13:19677398-19677420 CAGGTAAAACTGGACTAAGAGGG - Intronic
1105537913 13:21287403-21287425 GAGGGAAATCAGGAGAAATAGGG + Intergenic
1105579815 13:21684788-21684810 CAGAGAAGACTTGAGAAAGAAGG - Intronic
1105761436 13:23518775-23518797 AAGGTAAATCAGTAGAAAGAGGG - Intergenic
1105934408 13:25085926-25085948 CAGGGGACAGAGGAGAGAGAAGG - Intergenic
1106044788 13:26128942-26128964 CAGGGACAACAGCACAAAGTAGG + Intergenic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1106653985 13:31722570-31722592 AAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1107413872 13:40183044-40183066 CATTGAAAACAGGAGACAGAGGG - Intergenic
1107473135 13:40709837-40709859 CAGAAATAACAGGAGAAAGTGGG - Intergenic
1107523775 13:41209930-41209952 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1107614688 13:42153272-42153294 CAAGAAAAAGGGGAGAAAGAAGG - Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108310441 13:49184397-49184419 CAGGAAAGATAGGAGAAAGGAGG + Intronic
1108447067 13:50520176-50520198 CAGTGGAAACAGCAAAAAGAGGG + Intronic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1108826940 13:54423634-54423656 TAGGGAAACCAAGACAAAGAAGG - Intergenic
1109120909 13:58455740-58455762 CAGTAAAAAAAGGACAAAGAAGG + Intergenic
1109476913 13:62891423-62891445 GAGGGTAAAGGGGAGAAAGAAGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1109809046 13:67485114-67485136 CAAGGATAAGAGAAGAAAGATGG - Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1112412170 13:99173829-99173851 CAAGGAGAACTGGAGAAAGGAGG + Intergenic
1112610546 13:100950872-100950894 GAGTGAAAACAGGAGAAATTGGG - Intergenic
1113293877 13:108936570-108936592 CAGTAAAAAAAGGACAAAGAAGG - Intronic
1113333364 13:109353797-109353819 CAGGTAAACCAGGAGAAAGGAGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114970878 14:28026974-28026996 GAAGGAAAACAGAAGAGAGAAGG + Intergenic
1115054677 14:29108904-29108926 CAGAGAAAGAAAGAGAAAGAAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115348054 14:32364183-32364205 GAAGGAAGAAAGGAGAAAGAAGG + Intronic
1115515011 14:34176387-34176409 GGGGGAAGACAGGAGAGAGATGG - Intronic
1115902830 14:38172986-38173008 CATGGATGACAAGAGAAAGAGGG + Intergenic
1115908753 14:38231726-38231748 AATGGAAAACATGAGAAAGTGGG + Intergenic
1116027280 14:39530488-39530510 AATGGAAAACAGAAGAAAGTAGG + Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116252082 14:42499232-42499254 GAAGGAAGAAAGGAGAAAGAGGG - Intergenic
1116309202 14:43300379-43300401 CAGGAAAAACAGGGGCACGAGGG - Intergenic
1116659614 14:47692222-47692244 GAGGGAGAACACAAGAAAGAGGG - Intergenic
1116681103 14:47971298-47971320 CAGGTAAAACAGCATTAAGAGGG - Intergenic
1116712964 14:48392310-48392332 TAGGGAAGACAGCAGAGAGAAGG - Intergenic
1116912081 14:50479209-50479231 AAGGGACAACAGAAGAAAAAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117115538 14:52507061-52507083 CAGGGCAATCAGGAAAGAGAAGG + Intronic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117338221 14:54772993-54773015 AAGGGAAAATGGGAGAAAAAAGG + Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117530551 14:56656959-56656981 TGGGGAAACCAGTAGAAAGAGGG - Intronic
1117916916 14:60687448-60687470 CAGGGCAAGAAGGAGAAAGAAGG + Intergenic
1118437665 14:65786378-65786400 CAGGGTAAACAAGAGCAACAAGG + Intergenic
1118452399 14:65915873-65915895 GGGGGAAGAAAGGAGAAAGAGGG + Intergenic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119084869 14:71730444-71730466 CTGGGATTACAGGAGAGAGAGGG - Intronic
1119162487 14:72464645-72464667 CAGGGAAAACAGTAGATGAATGG - Intronic
1119192258 14:72690962-72690984 CAGGGAAAAGAGGAGAGAAAGGG + Intronic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119610771 14:76060066-76060088 CAGGGAAAACAGTACTAACAAGG + Intronic
1119902871 14:78276224-78276246 GAGGGAAAACAAAAGAAATAAGG + Intronic
1120064445 14:80024055-80024077 CAGAGCAACCAGGAAAAAGAGGG - Intergenic
1120299917 14:82692979-82693001 CAGGACACGCAGGAGAAAGAAGG - Intergenic
1120484773 14:85099294-85099316 AAGAGAAGAGAGGAGAAAGATGG + Intergenic
1120525162 14:85568918-85568940 GAGGGAAAAGAGGAGACAGACGG - Intronic
1120548456 14:85839994-85840016 CATGGAAACCAGAAGAAAGCTGG + Intergenic
1120854728 14:89202709-89202731 GAGGGAAAGCACGAGAGAGATGG - Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121990958 14:98556763-98556785 CAGGAAAAACATAAGAAATAGGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1123066628 14:105622405-105622427 CAGGGAAAGCTGGGGAAAGTGGG + Intergenic
1123407702 15:20031900-20031922 AATGGAAAACAGGAAAAAGCAGG + Intergenic
1123517028 15:21038554-21038576 AATGGAAAACAGGAAAAAGCAGG + Intergenic
1124046761 15:26157659-26157681 AAGGGAGAGAAGGAGAAAGAAGG - Intergenic
1124546897 15:30637260-30637282 CAGGATAAAGAGGATAAAGATGG - Intronic
1124780499 15:32627256-32627278 CAGGATAAAGAGGATAAAGATGG - Intronic
1124805370 15:32876348-32876370 CAGGGGAAACTGGGGAAACATGG + Intronic
1124816096 15:32994354-32994376 CAGGAAAAACAGGAGAGAGGTGG - Intronic
1124955017 15:34354619-34354641 GATGGAAAACAAGAGGAAGAAGG + Exonic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1124995927 15:34722684-34722706 CAGGGAGGAGAGGAAAAAGAAGG + Intergenic
1125010064 15:34862103-34862125 CTAGGAAAAGGGGAGAAAGAAGG + Intronic
1125274360 15:37975559-37975581 AATGGAAAACAGGAAAAAGCAGG - Intergenic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126145017 15:45465955-45465977 GAGGAACCACAGGAGAAAGACGG - Intergenic
1126155707 15:45563924-45563946 CAGGTAAAACATTGGAAAGATGG - Intergenic
1126464735 15:48951326-48951348 CTGGGAAGAGAGGGGAAAGATGG - Intronic
1126570619 15:50146751-50146773 AAGGGAAAAAAGGGGAAACAGGG + Intronic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127269885 15:57390893-57390915 GAGGGCAAAGAGGACAAAGAAGG + Intronic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1127568274 15:60214907-60214929 CAGAGGAAAAAGGAGAGAGAAGG + Intergenic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130359317 15:83167253-83167275 CAGTAAAAAAAGGACAAAGAAGG + Intronic
1130540078 15:84816238-84816260 TCAGGAAAATAGGAGAAAGAAGG + Intergenic
1130868078 15:87949126-87949148 CAGGGAAAACACTGCAAAGAGGG + Intronic
1131437382 15:92434220-92434242 AAGGGAAAAAAAAAGAAAGAGGG - Intronic
1131971706 15:97900242-97900264 CAGGGAGTACAGGAAAAAGAGGG - Intergenic
1131988974 15:98074284-98074306 CAGTAAAAAAAGGACAAAGAAGG - Intergenic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1134560287 16:15203183-15203205 GAGGGGAAGCAAGAGAAAGAGGG + Intergenic
1134771648 16:16814438-16814460 CAGAGAAAGCAGGAAACAGAAGG - Intergenic
1134920829 16:18114797-18114819 GAGGGGAAGCAAGAGAAAGAGGG + Intergenic
1136039921 16:27570595-27570617 AAGGGAAAACTTGATAAAGAAGG + Intronic
1136054440 16:27677915-27677937 CACGGGGAACAGGAGACAGAAGG + Exonic
1136331789 16:29584252-29584274 CAGGGAAAAAAAAAAAAAGATGG - Intergenic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137687215 16:50394484-50394506 CAAGAAAAAAAGGAGAAGGAAGG - Intergenic
1137739437 16:50753312-50753334 GAGGGAAGATTGGAGAAAGAGGG + Intronic
1138226408 16:55299279-55299301 CAGGGAAGACAGGAGCCAGCAGG - Intergenic
1138853270 16:60656193-60656215 GAGAGGAAACAGGAGAGAGAGGG + Intergenic
1139203860 16:65006374-65006396 CAGGGAAGAAGGGAGCAAGAAGG + Intronic
1139828770 16:69779458-69779480 CTGGGAAGGCAGGAGAAACAGGG - Intronic
1139846387 16:69924644-69924666 AAGGGGAGACAGGGGAAAGAAGG - Intronic
1139963498 16:70731377-70731399 CAGGAAAAGGAGGAGAGAGAAGG + Intronic
1139969540 16:70765266-70765288 CAGGGAAACAAGGAAAAACAAGG - Intronic
1140059772 16:71558079-71558101 CAAAGAAAACAAGAAAAAGAAGG + Intronic
1140192676 16:72831351-72831373 CTGGGAATACAGGTGAAATACGG + Intronic
1140207982 16:72949054-72949076 TAGGGAAAGGAGGAGAAAGCAGG - Intronic
1140419941 16:74811058-74811080 AAGAGAAAATAGGAGAAAGAAGG - Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140724435 16:77799314-77799336 GAGGGAGAAAAGGGGAAAGACGG - Intronic
1140729595 16:77843912-77843934 CAGGGAGAGCAGGAGACAGGTGG + Intronic
1140890541 16:79281037-79281059 CAGGGAGAAAAAGAGACAGAAGG + Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1142497706 17:315231-315253 CAGGGACTACAGGTGAATGAAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142753507 17:2002204-2002226 AAGGGAAAGAAAGAGAAAGAAGG - Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143410842 17:6707479-6707501 AAGGAAGAAAAGGAGAAAGAAGG + Intronic
1143595340 17:7910604-7910626 CAGGGAAAACTGGAGCTAGGGGG - Intronic
1143887247 17:10074109-10074131 CAACGATAACAGGAGAAAGCAGG + Intronic
1143995585 17:11003712-11003734 CAGGAAGAACAGGAGAAGCAAGG - Intergenic
1144096142 17:11902419-11902441 CATGGAAAAGAGGGGCAAGAAGG - Intronic
1144303447 17:13945264-13945286 CCAGGAAGACACGAGAAAGAAGG + Intergenic
1144405205 17:14945925-14945947 CAAGGAAAAAAGAAGATAGAAGG + Intergenic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1144687908 17:17238222-17238244 CAGTGAAGACCGGAGAGAGATGG + Intergenic
1144935903 17:18898839-18898861 CCAGAAAAAGAGGAGAAAGACGG - Intronic
1145051089 17:19661573-19661595 ATGGGAAAACAGCACAAAGAAGG + Intronic
1145398883 17:22515546-22515568 GAGGAAGAAGAGGAGAAAGAAGG + Intergenic
1145775107 17:27522255-27522277 CAGGAAAAACAGGACTGAGAAGG + Intronic
1145874768 17:28308995-28309017 GGGGGAAAAAAGGAGAAAAATGG + Intergenic
1146663115 17:34678340-34678362 AAGGGTAGACAGGAAAAAGAAGG - Intergenic
1146910741 17:36646855-36646877 CAGGAAGAATAGGAGAAAGGAGG + Intergenic
1147250420 17:39149903-39149925 CAAGGTAAACAGGAGAGAGTTGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147440685 17:40445521-40445543 CAGGGAAAACAGGAAGGAGGTGG + Intronic
1147470209 17:40651376-40651398 CTGGGAAGAAAGGAGAAAAAAGG + Intergenic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147652198 17:42069091-42069113 CAGGGAAGACAGGGAACAGAGGG - Intergenic
1147844136 17:43393104-43393126 CAGGGAAATGAAGTGAAAGATGG - Intergenic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148578768 17:48728959-48728981 GAGGGAAAAGAAGAGAGAGAGGG - Exonic
1148962206 17:51402748-51402770 AAGGGAAAAAAAGAAAAAGAAGG - Intergenic
1149370468 17:55989208-55989230 CTGGGAAGAGAGGAGAAAGGAGG - Intergenic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150067596 17:62124615-62124637 CAGGGAAATTAGGAGAGAAATGG + Intergenic
1150175361 17:63049110-63049132 TAAGTAAAACAAGAGAAAGAAGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150537202 17:66055158-66055180 CAGGGAAAACCTGTGAGAGATGG + Intronic
1150881630 17:69035666-69035688 CAGGCCATAGAGGAGAAAGAGGG + Exonic
1151549411 17:74813447-74813469 AAGGGGAGACAGGAGAATGAGGG - Intronic
1151572672 17:74935129-74935151 GAGGGAAGACAGCAGAGAGATGG + Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1153210504 18:2758220-2758242 AAAGGAAAACAGGAAAGAGAAGG - Intronic
1153368704 18:4288651-4288673 GGGGGAAAAAAGGAGAAAGAGGG + Intronic
1153684899 18:7535965-7535987 CATCCAACACAGGAGAAAGATGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1155338660 18:24792102-24792124 CAGGAAAAAAAGGGGAAAGGAGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155631313 18:27896918-27896940 CAAGAAAGACAAGAGAAAGAAGG + Intergenic
1156329378 18:36105115-36105137 CAGGCAAAAAAGGAGAAATATGG + Intergenic
1156330374 18:36115852-36115874 CAGGAAAAACAGGAGAAACATGG + Intronic
1156477885 18:37417659-37417681 CAGGTCAAATAGGAGAGAGACGG + Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1157005406 18:43577443-43577465 GAGGGAAAGAAGGAGAAGGAGGG - Intergenic
1157016672 18:43723190-43723212 CAGGGAAATCAGGCAAAAGAAGG + Intergenic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1157422303 18:47557303-47557325 CAGGGAACACAGGATAAGGTGGG - Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157981249 18:52383690-52383712 CAGAGAAACCAGGAAAATGAAGG - Intronic
1158411257 18:57208110-57208132 CAGGGCAAAGAGGATAAAGGAGG + Intergenic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158684960 18:59605172-59605194 CAGGGAGAAATGGAGAAGGAAGG + Intronic
1158862938 18:61610773-61610795 TAGGTCAAACATGAGAAAGATGG - Intergenic
1159530367 18:69648073-69648095 CAGCGAGAAAAGGAGAAACAAGG - Intronic
1159748333 18:72268417-72268439 GAGGGAATACAGGAAAAAAATGG - Intergenic
1160138204 18:76293237-76293259 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1160612889 18:80102471-80102493 AAGGGAAAAAAAGAGAAAAAAGG - Intergenic
1160667711 19:340852-340874 GAGGGCAAACAGAAGACAGAGGG + Intronic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1163062583 19:14771173-14771195 CAGGGAGAACAGGAGGGACAGGG + Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163348654 19:16761368-16761390 AAAGGAAAAAAAGAGAAAGAAGG - Intronic
1163469426 19:17487871-17487893 CATGGAAAAAAGTAGACAGATGG - Intronic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164712371 19:30366635-30366657 AAGGGAAAATAGGGGATAGATGG - Intronic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164869261 19:31629521-31629543 CAGGGAGAAGAAGAGAAAGGAGG + Intergenic
1165484929 19:36089869-36089891 CAGGGAATACGGGTGAATGAGGG - Intronic
1165844279 19:38808315-38808337 AAGGAAAAAGAGGAAAAAGAAGG + Intronic
1165900184 19:39165903-39165925 CAGGGAAAACAAGGCACAGAGGG - Intronic
1167651774 19:50734872-50734894 GAGGGCAAGCAGGAGAGAGATGG - Intergenic
1167792787 19:51691503-51691525 GAGGAAAAGCAGGAGAAAGAGGG + Intergenic
1167855246 19:52232304-52232326 CAAGAAAGAAAGGAGAAAGAAGG + Intergenic
1168144184 19:54410446-54410468 AAGGGACAAGTGGAGAAAGAGGG - Intergenic
1168192720 19:54751495-54751517 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168194808 19:54766323-54766345 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168197059 19:54782768-54782790 CAGAAAAAGCAGGAGAAAGCTGG + Intronic
1168200641 19:54812971-54812993 CGGAGAAAGCAGGAGAAAGCTGG + Intronic
1168207880 19:54865653-54865675 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
925285729 2:2714425-2714447 CAGGGAAAACATGGGAAACCTGG + Intergenic
925679787 2:6408509-6408531 CAGGTAAAATAGGAGAAGAAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925772424 2:7296442-7296464 CATGCAGCACAGGAGAAAGATGG + Intergenic
925846146 2:8035294-8035316 GAAGGAAAAAAGGAGAAGGAGGG + Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926092026 2:10057623-10057645 AAGGGAAAGAAGGAGATAGAGGG - Exonic
926194933 2:10757637-10757659 CAGGGATGACAGGACAAAGAGGG - Intronic
926414972 2:12640626-12640648 TAGGGAGAAAAGGAGAAATAAGG + Intergenic
926532825 2:14071886-14071908 CAGGAAAAACATTAAAAAGATGG - Intergenic
926732921 2:16050725-16050747 CAGGGAAACCAGCAGACAAAAGG - Intergenic
926894463 2:17669561-17669583 CAGGAAAACCAGGAAAGAGAGGG + Intronic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927671679 2:25073790-25073812 CCAGGAGAACAGGAGAAAAAGGG - Intronic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928249290 2:29660615-29660637 GAGGGAAACCAGGAGAAGGTGGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928859076 2:35834028-35834050 CAGGGAAAACAGGAAAATCATGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929757292 2:44778416-44778438 AAGGGAAAACAGGAGTTGGAGGG + Intergenic
929778175 2:44941426-44941448 TAGAGAAAAGAGGAGAGAGAGGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930216610 2:48703881-48703903 CAGGGCAATCAGGCGAGAGAAGG - Intronic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930463020 2:51708032-51708054 GAAAGAAAATAGGAGAAAGAGGG - Intergenic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931715137 2:65022841-65022863 CAGGGAAAACAAGGGAGTGAAGG - Exonic
931910122 2:66889917-66889939 CTGGGCAGAGAGGAGAAAGAAGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
932611271 2:73202302-73202324 CAGTGAGCAAAGGAGAAAGACGG + Exonic
932627133 2:73306782-73306804 AAGGGAAAATAATAGAAAGAAGG + Intergenic
932869045 2:75378217-75378239 CAAAGAAAACAGGAGACATAGGG + Intergenic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933023799 2:77228118-77228140 CAGGGAAAATCTGAGAAAAATGG + Intronic
933404770 2:81844055-81844077 CAGGGCAATCAGGTGAGAGAAGG + Intergenic
933833656 2:86229579-86229601 AAAGGAAGACAGGTGAAAGATGG - Intronic
933902708 2:86861313-86861335 CAGGGAGAACGGGAGCCAGAGGG + Intronic
934861327 2:97765607-97765629 CAGGCCAAACTGGAGAAACAAGG + Intronic
934908958 2:98233003-98233025 CAGAGATAGCAGGAGCAAGAGGG - Intronic
935431063 2:102976255-102976277 CAGGCAAGACAGGGCAAAGAAGG + Intergenic
935777840 2:106487955-106487977 CAGGGAGAACGGGAGCCAGAGGG - Intergenic
935946851 2:108294394-108294416 AGGGGAAAACAGAAGAGAGAGGG - Intronic
935984809 2:108662198-108662220 CAGGCAAAATGGGAGAAAGAAGG - Intronic
936023373 2:109012584-109012606 TAAGGAAAAGAGGAGAAAGCAGG - Intergenic
936034715 2:109101662-109101684 TAGTGAAAACAAGAGAAGGAAGG + Intergenic
936047817 2:109200668-109200690 CAGGGACACCAGGAGAAAAGAGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936137246 2:109905849-109905871 CAGGCAAAATGGGAGAAAGAAGG - Intergenic
936207451 2:110465636-110465658 CAGGCAAAATGGGAGAAAGAAGG + Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937358116 2:121211212-121211234 GAGGGAGAGGAGGAGAAAGAAGG + Intergenic
937484726 2:122303194-122303216 CAGCTAAAACAGTAGTAAGAAGG + Intergenic
937543924 2:122990817-122990839 AAGGAAAAAAAGGAGAAAGAGGG + Intergenic
937735520 2:125283017-125283039 GACGGAAAGCAGGAGAAAAATGG - Intergenic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938218578 2:129545470-129545492 CATGAAAAACAGGAGACAGATGG - Intergenic
938373229 2:130786967-130786989 AAGGGAAGGAAGGAGAAAGAAGG + Intergenic
938584915 2:132680690-132680712 TATGGAAAACGGGGGAAAGATGG + Intronic
939244530 2:139606624-139606646 CAGCAAAAACAGTAGTAAGAGGG - Intergenic
939316413 2:140556186-140556208 CAGGGGAGAAAGGAGAGAGAAGG - Intronic
939559025 2:143712076-143712098 TAGGGAAAACAGTAGAATGCTGG + Intronic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
940030125 2:149253279-149253301 CAGGGAAATCAGGTAAGAGAAGG - Intergenic
941061190 2:160849377-160849399 CAGAGATACCATGAGAAAGAAGG + Intergenic
941240336 2:163028427-163028449 CATGGAGAACAGGTGAGAGAAGG + Intergenic
941487073 2:166095536-166095558 CAGGAAGAACAGGAGAATCATGG - Intronic
941772004 2:169355159-169355181 GAAGGAGAACAGGAGAAAGAAGG - Intronic
942088817 2:172467989-172468011 CAGGAATCACAGGAGAAATAAGG - Intronic
942450646 2:176106400-176106422 AAGTGAAGACAGGAGAGAGAAGG + Intronic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942572956 2:177331769-177331791 CAGGGAAAACATAAGAAAACTGG - Intronic
942573350 2:177336453-177336475 CAGGGAAATCAGGAGAATCTGGG + Intronic
942809802 2:179984675-179984697 CAGGAAAATCAGGAGAAAGCTGG + Intronic
943089778 2:183360339-183360361 GAGGGCAAACAAGAGAATGAAGG - Intergenic
943263151 2:185692035-185692057 GAGGGAGAAAAGGAGAAAGCAGG - Intergenic
943740511 2:191402339-191402361 GAGAGAGAACAGGAGAAAAAAGG + Intronic
943806496 2:192131650-192131672 CAGGGAAAAGAGTAGAGACACGG - Intronic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944199141 2:197086758-197086780 CAGGGAAAACATCATTAAGATGG + Intronic
944352207 2:198742187-198742209 AGGGGAAAAGAAGAGAAAGAAGG - Intergenic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944487351 2:200220921-200220943 CAGGGCTATCAGGAGAGAGAGGG - Intergenic
945024887 2:205610848-205610870 AGGGGAAAAGAGGAGAAAGTGGG - Intronic
945396576 2:209325408-209325430 CAGGAATAAAAGGAAAAAGAAGG + Intergenic
945502006 2:210587754-210587776 GAGGCAAAACATGAGAAAGATGG + Intronic
945886215 2:215378633-215378655 CAGGGGAAACTACAGAAAGAGGG - Intronic
945950135 2:216031517-216031539 AAGGGAAAAGAAAAGAAAGAAGG + Intronic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
946565168 2:220956536-220956558 CAGAGAAAAGTGGTGAAAGAGGG - Intergenic
947008151 2:225536233-225536255 TTGGGAGAACAGGAGGAAGAAGG - Intronic
947130696 2:226921482-226921504 CAGTGAAAGCAGGACTAAGAGGG - Intronic
947218572 2:227771335-227771357 CAGTTAAACAAGGAGAAAGAAGG - Intergenic
947360711 2:229342634-229342656 CTGGGAAATCAGGGGAAACAAGG - Intergenic
947375413 2:229490194-229490216 CAGGGAATATAGCAGAAAGAGGG + Intronic
948041560 2:234905602-234905624 AAGAGAAAAGAAGAGAAAGAAGG + Intergenic
948088045 2:235267075-235267097 CAGGGAAGCCAGGAGAACGGGGG - Intergenic
948276045 2:236709570-236709592 CAGGGACCACAGGAGAGAGTTGG + Intergenic
948511545 2:238469029-238469051 CTGGGAAAAGAAGAGAAAAAGGG - Intergenic
1168996576 20:2137537-2137559 TAGGAAAAAGAGGAGCAAGAGGG - Intronic
1169400090 20:5272253-5272275 CGGGGAAAGCAGGATACAGAAGG - Intergenic
1169628177 20:7596550-7596572 GAGGGAAAGATGGAGAAAGATGG + Intergenic
1169672494 20:8118056-8118078 CAGGGAAAGGAGGAGAATTAGGG + Intergenic
1169752146 20:9005258-9005280 CAGTGACAAGAGGAGAATGAGGG + Intergenic
1169830385 20:9818692-9818714 CACGGAAAACACTAGAAACATGG + Exonic
1169974261 20:11305815-11305837 CAGGTAAAACGAGAGAGAGAGGG - Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170141561 20:13129986-13130008 GAGGCAAAATAGGAGAATGAGGG + Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171431798 20:25087616-25087638 CAGGGACAAAAGGAGAGGGAGGG + Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1172235929 20:33374507-33374529 CAGGCAAAGCAGGAAAAAAATGG + Intronic
1172419298 20:34801198-34801220 CAGTGAAAGCAGGACTAAGAGGG + Intronic
1172463124 20:35135043-35135065 CAGGATACCCAGGAGAAAGAGGG - Intronic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1172755469 20:37280731-37280753 AACCGAAAACAGGAGAAAAAAGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172909777 20:38399389-38399411 GAGGGCAAACAGGAGAAAAGGGG + Intergenic
1173126412 20:40340162-40340184 AAGGGAAGAGAGGAGTAAGATGG + Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173444927 20:43109095-43109117 CAAGGAAAACAGCAGAGAAAGGG - Intronic
1173596293 20:44260672-44260694 CAGGTAGAAGGGGAGAAAGAGGG + Intronic
1174434998 20:50499960-50499982 TGGGGCAAAGAGGAGAAAGAGGG - Intergenic
1174656693 20:52177611-52177633 CACCGAGAACAGGAGGAAGACGG + Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175861349 20:62151917-62151939 GAGGGAAAAGAGGAGAACGGGGG - Intronic
1176257732 20:64160867-64160889 CAGGTAAATCAACAGAAAGAAGG - Intronic
1176307499 21:5131587-5131609 CAGGGAAAAGAGGAAAAAAATGG - Intronic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177267554 21:18804240-18804262 AAGGAAAAAAAGGAGAAAAAGGG - Intergenic
1177327094 21:19605100-19605122 CAGGGAAAGCAGAGGAAAAAGGG + Intergenic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1177410802 21:20728450-20728472 CAGTGAAAAGGAGAGAAAGAGGG + Intergenic
1177638735 21:23819022-23819044 CAGGGACAACATGTGAAAGGAGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178115735 21:29414475-29414497 TGGTGAAAACAGCAGAAAGAGGG - Intronic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178369731 21:32017517-32017539 CAGGCAAAACAGGTGAAACAGGG - Intronic
1178370682 21:32024809-32024831 CATCCAACACAGGAGAAAGATGG + Intronic
1178468204 21:32868622-32868644 AAGGGAAAAGAAGAGAGAGAAGG + Intergenic
1178500595 21:33122875-33122897 AATGGAAAACATGAGAGAGAGGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178894548 21:36548135-36548157 CAAGGAAAAGAGGAGACAGAGGG - Intronic
1179296806 21:40070204-40070226 GAGAGAAAAAAGGAGAGAGAAGG + Intronic
1179356465 21:40664982-40665004 CGGGGAAAGCAGGAACAAGAGGG - Intronic
1179534311 21:42041360-42041382 CAGGGAGTGCAGCAGAAAGAAGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1179849561 21:44130443-44130465 CAGGGAAAAGAGGAAAAAAATGG + Intronic
1180239375 21:46490086-46490108 CAGAGAAAACAAGAGCGAGAGGG - Intronic
1180589616 22:16925864-16925886 AATGGAAAACAGAAAAAAGAAGG + Intergenic
1180789223 22:18565355-18565377 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181232518 22:21429956-21429978 CAAGGTCTACAGGAGAAAGAAGG - Intronic
1181246133 22:21504901-21504923 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1183838937 22:40481482-40481504 CAGGGAAAACATAATAAATAAGG + Intronic
1184027467 22:41868587-41868609 TTGGGAGAAGAGGAGAAAGAAGG - Intronic
1184059305 22:42072521-42072543 GGAGAAAAACAGGAGAAAGAAGG + Intergenic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184447328 22:44556626-44556648 CAGGGAAAATAGAAGAGAAAAGG - Intergenic
1184449723 22:44575799-44575821 GAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1184563933 22:45279968-45279990 GAGGGGAAACAGGAGAAAAAGGG - Intergenic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
1185345161 22:50307715-50307737 CGGGGAGAACAGGAGAAGGGGGG + Intergenic
949248085 3:1948755-1948777 TGGGGAAAATAGGACAAAGAAGG + Intergenic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950510684 3:13424614-13424636 CAGGGAGAAAAGGAGAAATGGGG - Intergenic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950886323 3:16366082-16366104 CAGGGAAGGCAGGGCAAAGAGGG + Intronic
951388479 3:22072671-22072693 AATGGAGAAAAGGAGAAAGAGGG + Intronic
951388483 3:22072689-22072711 GAGGGAGAAAGGGAGAAAGAGGG + Intronic
951953512 3:28228205-28228227 AAGGGAAAACTGGAGAGAGGAGG + Intergenic
951999242 3:28766812-28766834 CTGGAATAACAGGATAAAGAGGG - Intergenic
952009284 3:28881552-28881574 AAGGGAAAACACTAGAAAAATGG - Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952249966 3:31643634-31643656 CAGAGAAATTAGGAGTAAGAAGG - Intergenic
952447908 3:33401017-33401039 CTGGGGAGAAAGGAGAAAGAAGG + Intronic
953234953 3:41098007-41098029 CAGGGAAAATCTGAGCAAGAAGG - Intergenic
953360358 3:42290441-42290463 GAGGGAGGAAAGGAGAAAGAGGG - Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953888486 3:46733625-46733647 CAGGGAAAAAAGGTGAGTGAAGG - Exonic
954486950 3:50861680-50861702 CAGGAAAAAAAAGACAAAGAAGG - Intronic
954651381 3:52165918-52165940 CAGAGAAAATAGGGGAAAAAAGG - Intergenic
955042042 3:55327183-55327205 CATGGAAACCAGGGGAGAGATGG - Intergenic
955400903 3:58590922-58590944 AAGGGAAAACATGACACAGAAGG - Intronic
955446376 3:59015443-59015465 GAAGAAAAACAAGAGAAAGAGGG + Intronic
955518504 3:59751956-59751978 CAGGAAAGACTGGAGAAAGGTGG + Exonic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956373795 3:68592376-68592398 AGGGGAAAAAAGGAGAAATATGG - Intergenic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957314500 3:78559869-78559891 CATGGAATAAAGGAGCAAGAAGG + Intergenic
957535558 3:81498240-81498262 GTGGGAAAACAGTAGAAAGATGG + Intronic
957636649 3:82794086-82794108 AAGTGAAAACAGGAGAAGCAAGG + Intergenic
957646129 3:82930935-82930957 CATGGAAGACAGAAGAAAGTGGG + Intergenic
958012851 3:87902525-87902547 GAGGGAAAAAAAGATAAAGATGG + Intergenic
958057965 3:88438352-88438374 AAAGGTAAACAGGAGAAAGAAGG - Intergenic
958154344 3:89734521-89734543 CAGGGAAAGAAGCAAAAAGAGGG + Intergenic
958516570 3:95123680-95123702 CATGGAAAACAGGAAAAGAAGGG + Intergenic
958566955 3:95825789-95825811 TAGAGAAAACAGTAGAAATATGG + Intergenic
958778128 3:98509873-98509895 CACCCAACACAGGAGAAAGAGGG + Intronic
959699100 3:109281612-109281634 CCTGGAAATCAGGAGAAAGACGG - Intergenic
959883378 3:111472492-111472514 CAGGGAGAACAGAACCAAGATGG - Intronic
959905898 3:111711077-111711099 CAGGAAAAACATGGGAAAGAAGG - Intronic
960193935 3:114741921-114741943 CAGGGAAAATGGGAAAATGAAGG + Intronic
961908050 3:130283115-130283137 CAGGGAAAAGAGGAGAAACCAGG + Intergenic
962001485 3:131303151-131303173 AATGGAAAACAGGAAAAAGCAGG - Intronic
962259064 3:133891655-133891677 GAGGGAGGACAGGAGAGAGAAGG + Intronic
962306747 3:134294223-134294245 AAGGGAATAAAGGTGAAAGAAGG + Intergenic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
963376016 3:144466022-144466044 CAGGGAAGGGTGGAGAAAGAGGG - Intergenic
963513813 3:146282377-146282399 CAGGGAGAAAAAGAGAGAGAGGG + Intergenic
963936595 3:151060302-151060324 CAGGGAAGAAATGGGAAAGAAGG + Intergenic
964073084 3:152659040-152659062 AAAGGAAAAAAGGGGAAAGAGGG + Intergenic
964876383 3:161372560-161372582 GAGGGCAAACTGGGGAAAGAAGG + Exonic
964932773 3:162046711-162046733 TAGCCAAAACAGAAGAAAGAGGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965160299 3:165124432-165124454 CAGGGAAGAGGGAAGAAAGAGGG + Intergenic
965269810 3:166600684-166600706 CAGGCAGCACAGGAGAAAGATGG + Intergenic
965456744 3:168910871-168910893 AATGGAAAACAGGAGAAGGGTGG - Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965939894 3:174166937-174166959 CAGTAAAAAAAGGACAAAGAAGG - Intronic
966108444 3:176364993-176365015 CAGAGAAAAGAGGAAAAAAAGGG + Intergenic
966320599 3:178697427-178697449 AATGGAAAACAGGAAAAAGCAGG - Intronic
966352521 3:179046366-179046388 CAGGGAAAATAGCAGACAGGAGG + Intronic
966403517 3:179570963-179570985 CAGGGTAACCAGGAGACAAATGG + Intronic
966772419 3:183515811-183515833 CTGGAAAAAGAAGAGAAAGAGGG + Intronic
966821636 3:183929495-183929517 CAGGTAAACCAAGAGAAAGAGGG - Intronic
967311196 3:188107828-188107850 CAGGGAAAAAAAGAGAAATGAGG - Intergenic
967656864 3:192060890-192060912 GAGGAAATACAGGAGAAGGAAGG + Intergenic
967826573 3:193882079-193882101 CCGGGAACAAAGGAGAAGGATGG - Intergenic
967877042 3:194274582-194274604 CAGGGAAAAGAGGACAAAAGTGG + Intergenic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968905821 4:3450051-3450073 CAGGGAGGACAGGAGACAGGGGG + Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969279120 4:6157675-6157697 CAGTTTAAACAGGAGAAAGCAGG - Intronic
969681790 4:8647139-8647161 CAGGGAAAACATGGGAACGGCGG + Intergenic
969763816 4:9212422-9212444 CAGGGACAACTGGATAGAGATGG + Intronic
969939686 4:10718210-10718232 CAAGAAAGAGAGGAGAAAGAGGG + Intergenic
970294856 4:14618234-14618256 CATGGAAGACTGGAGAATGAGGG + Intergenic
970424659 4:15935038-15935060 CAAGGAAAACCAGAGAGAGAAGG - Intergenic
970464528 4:16309391-16309413 CATGGAAAACTGGAGAGAGGAGG + Intergenic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
971246397 4:24932768-24932790 CAGGGAAAACATTAGTCAGAGGG + Intronic
971276857 4:25206548-25206570 CAGTGAGAACAAGAGAAAGATGG - Intronic
971491338 4:27215336-27215358 CAGGAAAAGCAGCAAAAAGAAGG + Intergenic
971544852 4:27872463-27872485 AAGGGAAAGAAGTAGAAAGAAGG + Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972223195 4:36980111-36980133 TAAGGAAAACATGAGAAAGGGGG + Intergenic
972255482 4:37350677-37350699 CAGGGCAATCAGGCAAAAGAAGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
972887166 4:43506992-43507014 CTGGGAAAATAGCAGAAACACGG + Intergenic
973162008 4:47031113-47031135 CAGGGAAGAGTGGAGAGAGAGGG - Intronic
973595484 4:52484426-52484448 GAGGAAAAGAAGGAGAAAGAAGG + Intergenic
974169612 4:58249451-58249473 CAGGGAAAAAAGGAACAAAAGGG + Intergenic
974284659 4:59848183-59848205 TAGTTAAAACTGGAGAAAGAGGG + Intergenic
974469946 4:62305754-62305776 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
974475983 4:62380918-62380940 CAGGAAAATCTGGAGAAAGAAGG + Intergenic
974557874 4:63475329-63475351 AACAGAAAACAGGAGAGAGATGG - Intergenic
974803688 4:66852881-66852903 CAAGGAGAAAAGGAGAAAGAAGG + Intergenic
975087829 4:70364882-70364904 CTAGGAATCCAGGAGAAAGATGG + Intronic
975154939 4:71060693-71060715 CTGGGACTACAGGCGAAAGAGGG - Intergenic
975263551 4:72334119-72334141 CTGGGATTACAGGAGAAAGAAGG + Intronic
975424083 4:74206225-74206247 AAGGGAAAACTTGATAAAGAAGG + Intronic
975630070 4:76391519-76391541 CAGTGAAAGCAGTACAAAGAGGG + Intronic
975711531 4:77164865-77164887 CAAGGGAAATAGGAGAAAGATGG - Intronic
976211720 4:82677990-82678012 CAGGCCAAACAGGAGAGAGATGG - Intronic
976225574 4:82793385-82793407 GGAGGAAAACAGGAGGAAGATGG + Intronic
976510634 4:85905227-85905249 TACTGAAAAGAGGAGAAAGAAGG + Intronic
976854040 4:89581916-89581938 CATGCAGCACAGGAGAAAGATGG - Intergenic
977328772 4:95610184-95610206 GAGGAAAGACAGTAGAAAGAAGG + Intergenic
977349936 4:95870327-95870349 CAGGGAAGACATGGGAAAGGAGG + Intergenic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
977874644 4:102134643-102134665 TAGGGAAAACAAAAGACAGAAGG - Intergenic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978043250 4:104094970-104094992 AATGGAAAACAGGAAAAAGCAGG + Intergenic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
978793622 4:112687654-112687676 CAGAGAGAACAGGAGAGAAATGG - Intergenic
979480863 4:121215606-121215628 AAAGAGAAACAGGAGAAAGATGG - Intronic
979732263 4:124039241-124039263 CAAGAAAAAGAGGAGAAAAAGGG + Intergenic
980054322 4:128065029-128065051 CAGTGAAGACTGGAGAATGAAGG - Intronic
980217397 4:129870009-129870031 AAGGGAAAATGGGGGAAAGATGG + Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980657111 4:135803595-135803617 CAGGGAATACAGCACAAAAATGG + Intergenic
980801874 4:137762164-137762186 GAAGGAAAAAAGGAGAAAAAGGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981948117 4:150373807-150373829 CAGGGAAAAGAGGAGAGGTAAGG - Intronic
982060456 4:151599441-151599463 GAGAGAAAATAGGAGCAAGATGG + Intronic
982596921 4:157397258-157397280 CCGAGAAAACAGGAAAAAAAAGG + Intergenic
982719985 4:158849292-158849314 GAGGGGGAGCAGGAGAAAGAAGG + Intronic
982920538 4:161268202-161268224 CAGGGAAGACAGGAAAATGTGGG - Intergenic
983034805 4:162850406-162850428 CATGGAAAACATGCAAAAGAAGG + Intergenic
983576242 4:169264487-169264509 CAGGGAAAGAGGGAGAAAGGAGG + Intronic
984452005 4:179914299-179914321 CATGCAGCACAGGAGAAAGATGG - Intergenic
984510612 4:180674103-180674125 CAGGAGAAGCAGGTGAAAGATGG + Intergenic
984585067 4:181554008-181554030 GAGGGAAGACAGGGGAAAAAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985055261 4:186030542-186030564 CATGGAAAAGAGGAAAATGAAGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985167938 4:187117372-187117394 AAGGGAAAACATGAGAAAAAAGG + Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985409257 4:189665413-189665435 TCCGGAAAACTGGAGAAAGAGGG + Intergenic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
985983153 5:3488943-3488965 TAGGGAAAAAGGGAGAGAGAGGG - Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986211402 5:5676460-5676482 CATCGAAAACAGGAAAAATAAGG - Intergenic
986432759 5:7698013-7698035 AGGGGAAAAAATGAGAAAGAAGG - Intronic
986465378 5:8015985-8016007 CAGGGTTAACTGGAGAAAGTGGG + Intergenic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
986726020 5:10597359-10597381 AGGGGAAAACAGGAAAAAGCAGG + Intronic
986756591 5:10842536-10842558 AAGGGAAAAAAAGACAAAGAAGG + Intergenic
986761963 5:10888371-10888393 CTGAGAAATCAGGAGAGAGATGG - Intergenic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987141727 5:14953375-14953397 GAGGGGACTCAGGAGAAAGAGGG + Intergenic
987377697 5:17251786-17251808 GAGGGAGCAGAGGAGAAAGAAGG + Intronic
987436373 5:17898977-17898999 CAGTGAAAAAGGGAGAAAGAAGG - Intergenic
987566117 5:19588717-19588739 AATGGAAAACAGGAAAAAGCAGG + Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987922258 5:24298024-24298046 CATGGAAACCAGGAGAAAATGGG + Intergenic
988274379 5:29062101-29062123 CAGAGAAAATATGAAAAAGAGGG + Intergenic
988542292 5:32121375-32121397 AAGGAAAAACAAGAGAGAGATGG + Intergenic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
988920557 5:35937477-35937499 CTGGGCCAACAGGAAAAAGAAGG - Intronic
989206752 5:38816761-38816783 CAGGCAAAAGAGGAGAACCAGGG - Intergenic
989532838 5:42527380-42527402 AATGGAAAACAGGAAAAAGCAGG + Intronic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
990025926 5:51188653-51188675 CAAGGAAATCAGTGGAAAGAGGG - Intergenic
990332250 5:54739701-54739723 CATGGAAGACAAGAGAAAGAAGG - Intergenic
990430035 5:55725590-55725612 AAAGGAGGACAGGAGAAAGAAGG + Intronic
990766101 5:59184679-59184701 CAGGGAAAGCATTTGAAAGATGG - Intronic
990953821 5:61324186-61324208 AAGGGAAAGAAGGGGAAAGAAGG + Intergenic
991351782 5:65726865-65726887 CAGGAAAAACAGGAGAACACAGG - Intronic
991393083 5:66170645-66170667 CAGGGAAAAGGAGAGAGAGAGGG + Exonic
991482175 5:67092543-67092565 CAGGGAAAAAAGGATTAAGTAGG - Intronic
991522793 5:67519197-67519219 CAGGGAAAGGAGGGGAAAAAGGG - Intergenic
991984991 5:72275990-72276012 AAAGGAAAAAAGGAGAAAAAAGG + Intronic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992167379 5:74068005-74068027 CAGGAAAAACAGGAAAACGGGGG - Intergenic
992319717 5:75601614-75601636 CATGCAGCACAGGAGAAAGACGG - Intergenic
992589333 5:78277383-78277405 CAGGAAAAAAAGGAGAAGGGAGG + Intronic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993215305 5:85015037-85015059 CAGGTAAAGCAAAAGAAAGAAGG + Intergenic
993494356 5:88590740-88590762 CAGGGCAATCAGGCAAAAGATGG + Intergenic
993583328 5:89691974-89691996 GAGGGAAAGAAGGAGAAAGAGGG - Intergenic
993638016 5:90369315-90369337 CAGGTACTAGAGGAGAAAGAGGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994113587 5:96036759-96036781 CAGGGCAAACAAGACTAAGAAGG - Intergenic
994130790 5:96225239-96225261 GAGGGAAGAAAGGAAAAAGAAGG - Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994628527 5:102252001-102252023 GAAGGAGAAAAGGAGAAAGAGGG + Intronic
994639194 5:102385806-102385828 AAGGAAAAACAGGAGAAAAATGG - Intronic
995106499 5:108381905-108381927 CAGGGAAGCCGGGAGAACGATGG + Exonic
995260969 5:110104124-110104146 AAGGGAAAAAAAGAGAAACAAGG + Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
995367639 5:111381480-111381502 AAGGCAGCACAGGAGAAAGATGG + Intronic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
995765907 5:115618491-115618513 CAAGGAAAAAAGGAAAAACAAGG - Intronic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
996072277 5:119146141-119146163 CATGTAAAACATGAGAAAGCAGG - Intronic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
996477781 5:123940926-123940948 CAAGGAAATCATAAGAAAGAAGG - Intergenic
996831163 5:127742077-127742099 CAGGGAAATAAGGAGTAACAAGG - Intergenic
996904167 5:128578489-128578511 GAGGGGAAACAAAAGAAAGAAGG - Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997771130 5:136555667-136555689 CAGGGAAAACAAGAATAGGAGGG - Intergenic
998278756 5:140784109-140784131 GAGAGAAAACAAGAGAGAGAGGG - Intergenic
998684519 5:144508551-144508573 AAGAGAGAGCAGGAGAAAGAGGG + Intergenic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999271777 5:150300938-150300960 GAAGGAGAACAGAAGAAAGAAGG - Intronic
999586414 5:153094579-153094601 TAAGGAAAAGAGGGGAAAGAAGG + Intergenic
999897585 5:156052061-156052083 AAGGGAAAAAAGGGGAAACAGGG + Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000198662 5:158986178-158986200 AAGGGAAAACCAGAGAGAGAAGG - Intronic
1000230118 5:159307951-159307973 CTTGGAAAAAAGGAGCAAGAAGG + Intergenic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000606358 5:163331537-163331559 GAAGGAAAAAAGGAGAAAAATGG + Intergenic
1000634140 5:163624386-163624408 CAAGGAAAAAGGGAGAAAGCAGG + Intergenic
1000908573 5:166993586-166993608 TGGGGAAAACAGGAGAGAGAGGG + Intergenic
1001197868 5:169689956-169689978 TAGGGGAAACAAGGGAAAGAAGG + Intronic
1001220352 5:169895259-169895281 AAGGGAGGAAAGGAGAAAGAAGG - Intronic
1001791222 5:174459414-174459436 AAGGCAAAAAAGAAGAAAGAGGG + Intergenic
1001850893 5:174964035-174964057 CAGGGAAAAGATGAAATAGAGGG + Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002656531 5:180753240-180753262 CAGGGAAAAGGTGAGCAAGAGGG + Intergenic
1002870688 6:1164932-1164954 CAGGAAAAAAAGGAGAAACCAGG + Intergenic
1002937680 6:1687553-1687575 CCTGGAACACAGGAGAAGGACGG - Intronic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1003285943 6:4734138-4734160 GAGGGGAAACAGCAGAGAGAGGG - Intronic
1003712145 6:8603852-8603874 GAGGGAAGGAAGGAGAAAGAAGG - Intergenic
1004356642 6:14934949-14934971 CATGGAAAACAGAAAACAGATGG + Intergenic
1004509938 6:16277258-16277280 CAGAGAAACCAGGAGAGACAGGG - Intronic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005283817 6:24302998-24303020 CAGGCAGAAAAGGAGAAAAATGG - Intronic
1005381736 6:25242128-25242150 CATGGAAAACTGGAGAAAACTGG - Intergenic
1005574717 6:27180287-27180309 CCGGGAAAACATGAGAGATAGGG + Intergenic
1005583082 6:27251547-27251569 CAGGGAAGACCCGAGAAGGAGGG + Intronic
1005962891 6:30705966-30705988 AAGGTAAAAGGGGAGAAAGAAGG + Exonic
1006630851 6:35428543-35428565 CAGGAAAGACAGGAGAGAGCTGG - Intergenic
1007012984 6:38435579-38435601 GAGGGAAAAGAAAAGAAAGAAGG - Intronic
1007125672 6:39423659-39423681 CAGGAACAACAGGAAAAACAGGG - Intronic
1007478683 6:42135974-42135996 CAGGAAAAACAAGAGATGGAGGG - Intronic
1007941380 6:45784841-45784863 GAGGGAGGATAGGAGAAAGAAGG - Intergenic
1008503610 6:52207959-52207981 CTGGGGAAATAAGAGAAAGAAGG - Intergenic
1008836058 6:55831919-55831941 CATGGGTAACAGGAGAGAGAAGG + Intronic
1008858310 6:56117924-56117946 CAGCAAAAACAGTAGTAAGATGG + Intronic
1009214882 6:60909815-60909837 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1009332713 6:62443863-62443885 AATGGAAAACAGAAGAAAGAAGG - Intergenic
1010164249 6:72897121-72897143 CAGGCATAGAAGGAGAAAGAAGG + Intronic
1010315160 6:74439438-74439460 GATGGAAAACATGAGACAGATGG + Intergenic
1010414607 6:75599647-75599669 GAGGGGAAAGAGGAGAGAGAAGG + Intergenic
1010627844 6:78160400-78160422 CTGGGAAAAGAGGAGAGACAAGG - Intergenic
1010707939 6:79136367-79136389 AATGGAAAACAGGAAAAAGAAGG + Intergenic
1011179082 6:84598877-84598899 CAGGGACACCTGGTGAAAGATGG - Intergenic
1011396549 6:86915776-86915798 CTGGTAAAATAGGAGAAAAATGG - Intergenic
1011402248 6:86976142-86976164 TATGGAAAACAGGAGGGAGAGGG + Intronic
1011417446 6:87137328-87137350 GAGGAGAAAGAGGAGAAAGAGGG - Intergenic
1012088358 6:94858949-94858971 TAGGGGAAAAAGCAGAAAGAGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012386203 6:98686027-98686049 CAGGAAAAACAGGAATAAAATGG + Intergenic
1012589841 6:100967835-100967857 CATGGAAAACAGAAAAAAGCGGG + Intergenic
1012839515 6:104311702-104311724 AATGGAAGAGAGGAGAAAGAGGG + Intergenic
1013842087 6:114408464-114408486 CAGGTAAAACTAGAAAAAGATGG + Intergenic
1013896967 6:115101025-115101047 AATGGAAAACAGGAAAAAGTAGG - Intergenic
1014281801 6:119449619-119449641 CTAGAAAAACAGGAGAAAGTGGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014835083 6:126151866-126151888 CAAGGAAGGAAGGAGAAAGAAGG - Intergenic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015969456 6:138729819-138729841 CAGGGAAAAGAGGATAGAGTTGG + Intergenic
1016235178 6:141855581-141855603 TATCCAAAACAGGAGAAAGATGG + Intergenic
1016857227 6:148683350-148683372 CTGTGTAAACAGGAGACAGATGG - Intergenic
1017107004 6:150897262-150897284 TTGGGAAAACTGGAGATAGATGG - Intronic
1017553361 6:155535724-155535746 AAGGGAAAATGGGAGAAAAAGGG - Intergenic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1017758357 6:157548979-157549001 CAGGTATAACAGGATACAGATGG - Intronic
1017890284 6:158632278-158632300 CATGGAAAAGGGAAGAAAGAGGG - Exonic
1017921630 6:158877988-158878010 AAGGGAAATAATGAGAAAGATGG - Intronic
1017990244 6:159481293-159481315 GAGGCAAAACAGGAGACAGTAGG - Intergenic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018934757 6:168266395-168266417 CAAGGAAAAGAAGAGAGAGAGGG - Intergenic
1019384929 7:749481-749503 AAGGCAGAACAGGAGAATGAAGG - Intronic
1020642545 7:10774295-10774317 CATGGAAGACAGGAAAAAAAAGG + Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021572066 7:22076020-22076042 CAAGCTAAACAGGTGAAAGAGGG - Intergenic
1021840763 7:24719921-24719943 CAGGGAATACAGGATTATGATGG + Intronic
1022100955 7:27168922-27168944 AAGGGAAGACAGGGAAAAGAAGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022607071 7:31825821-31825843 CAGGGAAAACAGGAAATAGAAGG + Intronic
1022996066 7:35756625-35756647 AGGGGAAAGAAGGAGAAAGAAGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023297807 7:38734542-38734564 CAGAGAAATAAGGAGAAAGGGGG - Intronic
1023309385 7:38868290-38868312 CTGGTAAAACATGAGAAAGCAGG + Intronic
1023482598 7:40650206-40650228 CAGGGCAAGGAAGAGAAAGAGGG + Intronic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023886139 7:44358157-44358179 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1024171357 7:46791147-46791169 AAGGGAAAGCAAGAGAAGGAAGG + Intergenic
1024218298 7:47266518-47266540 CAGGGCAAAGGGCAGAAAGAGGG + Intergenic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1025167681 7:56727173-56727195 CAGGAAAAGCAAGATAAAGAAGG + Intergenic
1026149203 7:67773736-67773758 AAGGGAGAAAGGGAGAAAGAGGG - Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1027352870 7:77329374-77329396 CCTAGAAAACAGGAAAAAGAAGG - Exonic
1027457434 7:78410698-78410720 CAGGGAGAAAAAGAGTAAGATGG + Intronic
1027547736 7:79550296-79550318 CTGGGAAAAGAAGGGAAAGAAGG - Intergenic
1027671518 7:81105190-81105212 CAGGTAAAACATGAAAGAGATGG + Intergenic
1027715250 7:81661344-81661366 CAGTTAAAAAAGGACAAAGAAGG + Intergenic
1027762112 7:82292250-82292272 CAAGGAAAACATGAGGCAGATGG - Intronic
1027923023 7:84420313-84420335 GAGGGAAACCAGGAAAATGATGG + Intronic
1028064196 7:86361081-86361103 CAAGGTAAAGAGGATAAAGATGG + Intergenic
1028176732 7:87669298-87669320 AATGGAAAACAGAAAAAAGAAGG - Intronic
1028218941 7:88171516-88171538 CATGGACAAGAAGAGAAAGAGGG - Intronic
1028248796 7:88515117-88515139 ATGGGAAGAGAGGAGAAAGAAGG + Intergenic
1028523158 7:91753987-91754009 CAGGGAAAACAAAACCAAGATGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028678249 7:93493511-93493533 CAGGGAACTGAAGAGAAAGATGG - Intronic
1029025012 7:97407205-97407227 AGGGGAAAAAAGGAGAGAGAAGG + Intergenic
1029171855 7:98636129-98636151 CAGCCAGCACAGGAGAAAGATGG - Intergenic
1029194875 7:98798249-98798271 CAGGAAGAGCAGGAGAGAGAAGG + Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029504012 7:100951293-100951315 CAGGGAAAGCTGAACAAAGAGGG - Intronic
1030167967 7:106573562-106573584 TAGAGGAAACAGCAGAAAGAAGG - Intergenic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1031331022 7:120464795-120464817 ACGGGAATACATGAGAAAGAAGG - Intronic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1031884903 7:127236295-127236317 TAGGGAGAAGCGGAGAAAGAAGG - Intronic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032527899 7:132593714-132593736 CCCTGAAGACAGGAGAAAGAGGG + Intronic
1032646825 7:133834196-133834218 AAGGAAAAAAAGGAGAAAAAGGG - Intronic
1033143844 7:138853705-138853727 GAGGCAAAACAAGGGAAAGAGGG + Intronic
1033785216 7:144721962-144721984 CAGGAAAAAAAGGGGAAGGAGGG - Intronic
1033924318 7:146438822-146438844 CAGGGAATACTGGAAAAATAGGG + Intronic
1035097398 7:156366515-156366537 CACGGGAAACAGGAGAACCAAGG + Intergenic
1035245450 7:157559838-157559860 GAGAGAACACAGGAGAGAGACGG - Intronic
1035561719 8:609529-609551 TAGGGAAAACTGGAGAGAGGAGG - Intergenic
1035793461 8:2330486-2330508 CAGGGAAATAAGAAAAAAGATGG - Intergenic
1035799343 8:2391219-2391241 CAGGGAAATAAGAAAAAAGATGG + Intergenic
1035893658 8:3373269-3373291 GAGGGAAAACATCAAAAAGAGGG - Intronic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1036545881 8:9769443-9769465 CAGGGAAAAAAGTAGAAACTGGG - Intronic
1036924859 8:12894474-12894496 CAGGGAAAAAAGGGGACATATGG + Intergenic
1037154381 8:15682420-15682442 CAGTTAAAAAAGGACAAAGAAGG - Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037416144 8:18651933-18651955 CAGGGAAGATTGGAGACAGAAGG + Intronic
1037616065 8:20520004-20520026 GAGGGAAAAAATGAGAGAGAAGG - Intergenic
1038067121 8:23974774-23974796 GAGGAAAAGGAGGAGAAAGAGGG + Intergenic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038660527 8:29492937-29492959 TGGGACAAACAGGAGAAAGAAGG - Intergenic
1039100949 8:33941588-33941610 CACGGAAAAAAGAAGTAAGAAGG - Intergenic
1039102904 8:33959392-33959414 CAGGGAAAAAAGGAGAAAACAGG + Intergenic
1039369431 8:36969881-36969903 CAGGGAAGGCTGGGGAAAGAAGG - Intergenic
1039372120 8:36995547-36995569 AAGGAATAACAGGAAAAAGAAGG - Intergenic
1039837773 8:41270445-41270467 CAGAGAAAAGAAGAAAAAGAGGG + Intronic
1040404191 8:47084277-47084299 AATGGAAAACAGGAGAAAGCAGG - Intergenic
1041439575 8:57879561-57879583 CAGGGAAAACAAGATATAAATGG - Intergenic
1041543101 8:59009210-59009232 CAAGAAAGAAAGGAGAAAGAGGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1041822058 8:62047888-62047910 AAGAGAAGAAAGGAGAAAGAAGG - Intergenic
1041880487 8:62744100-62744122 AAAGGAAAGCAGGAGAAAGAAGG + Intronic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043015630 8:74937152-74937174 CAGTGAAAACAGTAATAAGAGGG - Intergenic
1043019047 8:74977841-74977863 CAGGGAAAACACGGGAAATATGG - Intergenic
1043667759 8:82838763-82838785 AAGGAAATACGGGAGAAAGAAGG - Intergenic
1043825064 8:84917308-84917330 CAGGGAAATAAGGACAGAGAAGG + Intronic
1044558982 8:93594087-93594109 AAGGAATAACAGGAGAGAGATGG - Intergenic
1045678875 8:104637470-104637492 CATCGAGTACAGGAGAAAGATGG + Intronic
1046359126 8:113127489-113127511 GAGGGAAAGTAGGAGACAGAGGG - Intronic
1046507444 8:115154333-115154355 CAGAGAAAAAAAGAGAAAAAGGG - Intergenic
1046699967 8:117389091-117389113 CAGGGGCCACAGGAGAAATAGGG + Intergenic
1047113652 8:121817751-121817773 AAGGGAAAAAAGGAGAAAAAGGG - Intergenic
1048047970 8:130791239-130791261 CAGGGAAAAGGGGAGAATGCTGG + Intronic
1048163947 8:132045553-132045575 AAGGGAAACCAGGAGAAGGCAGG - Intronic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1049008098 8:139869893-139869915 CATGGAAAAGAGTAGAAACAGGG + Intronic
1049052619 8:140210578-140210600 CAGGGAATCCAGGAGAGAAAGGG - Intronic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1049477016 8:142801589-142801611 CAGCTAAATCAGGAGAAAGATGG + Intergenic
1050572724 9:6958182-6958204 CAGAGTTAACAGGTGAAAGACGG - Intronic
1050584203 9:7093223-7093245 CAGGAAACACAGGAAAATGAAGG + Intergenic
1050938757 9:11431754-11431776 CAGGGAGAAAAAGAAAAAGAAGG + Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1051343257 9:16130239-16130261 GAGGGAAATCAGGAGATAGCAGG - Intergenic
1051461372 9:17320386-17320408 CATGGAAAAAAAAAGAAAGATGG - Intronic
1051931170 9:22388212-22388234 TGGGGAAAACAGGCCAAAGAAGG - Intergenic
1052003681 9:23320221-23320243 GAAAGGAAACAGGAGAAAGAAGG + Intergenic
1052089001 9:24304031-24304053 ACGGTAAAAAAGGAGAAAGATGG + Intergenic
1052970683 9:34375601-34375623 CAAGGAAATAAGGAGAGAGAGGG + Intronic
1053336983 9:37283548-37283570 ATAGGAAAACAGGAAAAAGAGGG - Intronic
1053554764 9:39124362-39124384 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1053818882 9:41944620-41944642 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1054109150 9:61088272-61088294 CAGGAAAAAAAGAAGAAACAAGG + Intergenic
1054611707 9:67242853-67242875 CAGGAAAAAAAGAAGAAACAAGG - Intergenic
1054801488 9:69354224-69354246 TAGGGCAAACAAGAGAAAGAGGG - Intronic
1055092221 9:72374559-72374581 CAGGGGATAGAGGGGAAAGAGGG + Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055372321 9:75613372-75613394 CAGGGAAGCCAGGGGACAGATGG - Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055917605 9:81421647-81421669 CAGTAAAATCAGGAGACAGAGGG + Intergenic
1056034150 9:82585713-82585735 CAGGGAAAAGAGAAAATAGAGGG + Intergenic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1058117123 9:101097074-101097096 CAGGGAGAACAGCTGAATGAGGG + Intronic
1058117411 9:101099843-101099865 AGGGGAGAAGAGGAGAAAGAAGG - Intronic
1058810323 9:108632826-108632848 CTCAGAAAACAGCAGAAAGATGG + Intergenic
1059396206 9:114035547-114035569 CAAGGAAAAGAAGAAAAAGACGG - Intronic
1059548206 9:115200555-115200577 TAGGGAAAAAAGAAAAAAGAAGG - Intronic
1059557477 9:115295840-115295862 CAGGCAAAACAAGAGAAATATGG + Intronic
1059788784 9:117617044-117617066 AAGGGAAGACAAGAGAAAGCAGG - Intergenic
1060675392 9:125509831-125509853 CAGGGAAAACAGGGGAGTCAGGG + Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1061100156 9:128486011-128486033 GAAGGAAAAAAGGAGAATGATGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061673907 9:132204545-132204567 CAGGAAAAACAGGGGCAAGAAGG + Intronic
1062112506 9:134789867-134789889 TTGGGAAAACAGGAGAGAGATGG + Intronic
1203654155 Un_KI270752v1:7479-7501 CAGGGAAAACAAGGGAGGGAAGG + Intergenic
1185461699 X:335654-335676 CAAGGAAAACAGCAGAACAAAGG + Intronic
1185749706 X:2600959-2600981 CGGGAAAAACAGGAGCAACACGG - Intergenic
1186952947 X:14647524-14647546 AAGGGAAAACAGGAGACCAATGG + Intronic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187231765 X:17430151-17430173 AAGGGAAGGAAGGAGAAAGAAGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187732420 X:22269256-22269278 TAGGGCAAAGAGGTGAAAGAAGG - Intergenic
1187769091 X:22675534-22675556 CTGGGACAATAGGTGAAAGAAGG - Intergenic
1188067766 X:25682528-25682550 CAAAGAAATAAGGAGAAAGAGGG - Intergenic
1188380154 X:29481677-29481699 CAGGAAAAACAGGAGCAACCAGG - Intronic
1188805003 X:34577337-34577359 CAGTGAACACTGGAGAAAGCTGG - Intergenic
1188915654 X:35906815-35906837 CAGGGAAAGCAGTACTAAGAGGG - Intergenic
1188922314 X:35992134-35992156 AAGGGAAAAGAGAAGAAACAGGG - Intergenic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189548107 X:42064325-42064347 CAAGTAAAAAAGGACAAAGAAGG - Intergenic
1189651972 X:43199793-43199815 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1189734600 X:44056986-44057008 GAGAGAAAGGAGGAGAAAGATGG - Intergenic
1189878326 X:45461165-45461187 CAGTAAAAAAAGGACAAAGAAGG - Intergenic
1189882940 X:45510927-45510949 GAGGGAAAAGGGGAGAAGGAGGG - Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190568233 X:51753018-51753040 CAGAGAAGACAGGACACAGAGGG - Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1190934568 X:54985170-54985192 CAGAGAGAACAAGAGAGAGAGGG + Intronic
1191060631 X:56292004-56292026 CTGGGAGAAAAGTAGAAAGAGGG + Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1192959777 X:76115804-76115826 CAGTGAAAGCAGTACAAAGAGGG + Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1193425273 X:81334976-81334998 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1193932718 X:87575631-87575653 CAGGAAAAACAGGTGATATAAGG + Intronic
1194200357 X:90947469-90947491 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1194263780 X:91731633-91731655 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1194431751 X:93816262-93816284 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1195025519 X:100873080-100873102 CAGGCAAAACAGAAGAGAGAAGG - Intronic
1195049786 X:101086684-101086706 GAAGAAAAACAGGAAAAAGATGG - Intronic
1195121322 X:101755935-101755957 GAGGGAAGGAAGGAGAAAGAAGG - Intergenic
1195306376 X:103586946-103586968 GAGGGAAAACCAGAGATAGAGGG + Exonic
1195328500 X:103777287-103777309 AAGGGAAAAGAGAAGATAGAGGG - Intronic
1195350380 X:103990122-103990144 CAGGGAAATCAGGCAAGAGAAGG + Intergenic
1195384419 X:104300311-104300333 CAGGGATAACAGTGGAAAGGAGG - Intergenic
1195641917 X:107184626-107184648 CAGAGACAAGAAGAGAAAGAGGG + Intronic
1195730706 X:107964255-107964277 CAGGGAAAACGAGGGAAAGTTGG - Intergenic
1195961321 X:110389789-110389811 AAGGAAGAACAGCAGAAAGAAGG + Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196322933 X:114364401-114364423 CTTGGAAAACATGAGAAACAAGG + Intergenic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic
1197622860 X:128770683-128770705 AAGGGAAGAAAGGAGAAATAAGG - Intergenic
1197758467 X:130012326-130012348 CAGGGTAAACAGTCCAAAGAGGG + Intronic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198341481 X:135718722-135718744 AAAGTAAAACAGAAGAAAGATGG - Intronic
1198346517 X:135764641-135764663 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198348423 X:135781926-135781948 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198350327 X:135799190-135799212 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198352235 X:135816462-135816484 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198354143 X:135833730-135833752 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198356053 X:135850980-135851002 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198357966 X:135868258-135868280 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198359881 X:135885541-135885563 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198366726 X:135947330-135947352 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198508117 X:137321528-137321550 CAAGGAAAAAAGAAGAAAGTAGG - Intergenic
1199196209 X:145033701-145033723 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1199418335 X:147613151-147613173 CCGGGAAAATAGGTCAAAGAGGG - Intergenic
1199431403 X:147764480-147764502 AAGGGAAAAAGGGAAAAAGAAGG - Intergenic
1199597416 X:149517165-149517187 CAGTAAAAAAAGGACAAAGAAGG + Intronic
1199709593 X:150459792-150459814 AAGAGAAGAAAGGAGAAAGATGG + Intronic
1200043152 X:153384429-153384451 CAAGGAAAGCAGGAGAGAGAGGG + Intergenic
1200526720 Y:4282132-4282154 AATGGAAAACAGAAAAAAGAAGG + Intergenic
1200546352 Y:4523864-4523886 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1200854921 Y:7927301-7927323 AAGTGAAAACAGTACAAAGATGG - Intergenic
1200868134 Y:8067424-8067446 TAGGGAAAACAGAATAAAGATGG + Intergenic
1201273561 Y:12278565-12278587 CAGGAAACAGAGGAGACAGAAGG - Intergenic
1201512546 Y:14780905-14780927 CAGAGACAGCAGGAAAAAGAAGG + Intronic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201918147 Y:19204769-19204791 CATGGCAGGCAGGAGAAAGAAGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic
1202070737 Y:20989449-20989471 CTGGGAAAAGAGGAGAAATAAGG - Intergenic
1202264552 Y:23004316-23004338 CAAGTAAAACAGTACAAAGATGG + Intronic
1202265550 Y:23013954-23013976 CAGGGAATACAGCACAAAGTTGG + Intergenic
1202417543 Y:24638058-24638080 CAAGTAAAACAGTACAAAGATGG + Intronic
1202418543 Y:24647696-24647718 CAGGGAATACAGCACAAAGTTGG + Intergenic
1202452243 Y:25022390-25022412 CAGGGAATACAGCACAAAGTTGG - Intergenic
1202453243 Y:25032028-25032050 CAAGTAAAACAGTACAAAGATGG - Intronic
1202598582 Y:26569395-26569417 CAGGAACAACAGAAGAATGACGG + Intergenic