ID: 987797260

View in Genome Browser
Species Human (GRCh38)
Location 5:22644195-22644217
Sequence ATGGTGAAGCATAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 6, 3: 141, 4: 696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987797257_987797260 9 Left 987797257 5:22644163-22644185 CCCACAACTCTCACTTAAATCAA 0: 1
1: 0
2: 1
3: 19
4: 206
Right 987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG 0: 1
1: 0
2: 6
3: 141
4: 696
987797258_987797260 8 Left 987797258 5:22644164-22644186 CCACAACTCTCACTTAAATCAAA 0: 1
1: 1
2: 2
3: 42
4: 581
Right 987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG 0: 1
1: 0
2: 6
3: 141
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987797260 Original CRISPR ATGGTGAAGCATAGTGAAGA AGG Intronic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
902407935 1:16196477-16196499 ATGGTGTAGTATAGGGACGAAGG - Intergenic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
905002200 1:34681404-34681426 ATGGTGAAACATAGTAATAAAGG + Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
906558824 1:46738596-46738618 ATGATTAAGCTTAGTGACGAAGG - Intergenic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
908340769 1:63176504-63176526 ATGGTTAAGCTTAGTGACGAAGG - Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909735600 1:78957310-78957332 ATAATTAAGCATAGTGAGGAAGG + Intronic
909767203 1:79371414-79371436 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
909904843 1:81182158-81182180 ATGGTTAAGCTTACTGATGATGG - Intergenic
909916090 1:81321432-81321454 ATGATGAAGCTTAGTGAGAAAGG - Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910054855 1:83021282-83021304 ATGATGAAGCTTAGTGAGAAAGG - Intergenic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910269832 1:85382074-85382096 ATTATGAAGCTTAGTGAGGAAGG + Intronic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910451991 1:87356677-87356699 ATGGTGAAGCAAAACAAAGATGG + Intergenic
910495251 1:87819695-87819717 ATGGTGCAGGAAAGAGAAGAGGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911234731 1:95399952-95399974 GAGGTCAAGCAGAGTGAAGAGGG + Intergenic
911294439 1:96097459-96097481 AAGATGAAGGATAGTGCAGAGGG - Intergenic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911897018 1:103449024-103449046 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
911905349 1:103561220-103561242 ATGGTGAAGCATCTAGTAGATGG + Intronic
911969890 1:104419169-104419191 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
912954142 1:114141161-114141183 ATAATGAAGCTTAGTGAGGATGG + Intronic
913127018 1:115800927-115800949 ATGATTAAACTTAGTGAAGAAGG - Intergenic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
914977169 1:152377323-152377345 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
915039232 1:152953924-152953946 ATGGTGGAGCACACTGAAGCTGG - Intergenic
916948092 1:169749528-169749550 ATGATGAAGCTTAGTGAAAAAGG - Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
917669467 1:177259013-177259035 ATGATTAGGCATAGTGAGGAAGG + Intronic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917950909 1:180034915-180034937 ATGATTAAGCTTAGTGACGAAGG + Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918016823 1:180642876-180642898 ATGTTAACACATAGTGAAGAGGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918131897 1:181636969-181636991 ATGGGGGTGCATATTGAAGAGGG - Intronic
918322228 1:183375187-183375209 ATGGTGAAGAATTCTGAATAGGG - Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921091029 1:211843270-211843292 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921301709 1:213757212-213757234 ATAGTTAAGCTTAGTGAGGAAGG + Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921313913 1:213872748-213872770 ATGATGAAGCTTTGTGGAGAAGG + Intergenic
921409142 1:214815791-214815813 ATGGTGATGCATTGTCAAGCTGG - Intergenic
921546208 1:216478050-216478072 AAGGTGAAGCCATGTGAAGATGG + Intergenic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
922032482 1:221815019-221815041 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923643454 1:235790698-235790720 ATGGTGATGGAAAGTGAAGTAGG - Intronic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924180954 1:241438125-241438147 AGGGTGAAGAACAGGGAAGAAGG - Intergenic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064788363 10:18925451-18925473 ATTATTAAGCTTAGTGAAGAAGG - Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066171338 10:32850275-32850297 ATCATGAAGCAGAGTGTAGAAGG + Intronic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1067186682 10:44035108-44035130 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
1067301887 10:45019184-45019206 ATGGTTAAGCTTAGTGGGGAAGG - Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068153191 10:53161008-53161030 ATGATGACACATAGTAAAGAAGG + Intergenic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069087134 10:64153982-64154004 ATGATTAAGCTTAGTGAAGTAGG - Intergenic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070944734 10:80380542-80380564 ATGGTTAGGCTTAGTGAGGAAGG - Intergenic
1071138609 10:82480813-82480835 ATGGTCAAGCCTAGTGCTGATGG + Intronic
1071438754 10:85670773-85670795 ATGGTCAAGCATTGTCAAGTTGG - Intronic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1072094779 10:92167350-92167372 ATGATTAAGCTTAATGAAGAAGG - Intronic
1073598972 10:104828210-104828232 ATGGTTAAGCTTAGCAAAGAAGG - Intronic
1073603071 10:104865624-104865646 TTGATGAAGCATAGAGAAGTAGG + Intronic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1073932676 10:108594246-108594268 ATGTGGAAGCATAATGAAGCAGG - Intergenic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076260445 10:129060750-129060772 TTGGGGAAGCAAAGTGAACAAGG - Intergenic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1079585336 11:22119713-22119735 TTGGTGAAGCCTAGGAAAGAAGG - Intergenic
1079955452 11:26857535-26857557 ATGGTAAAGTAGAGTGAAAAAGG + Intergenic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083166979 11:60895679-60895701 ATGATTGAGCTTAGTGAAGAAGG - Intronic
1085830847 11:79899278-79899300 TGGGTGAAGCATGGTCAAGATGG - Intergenic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086778343 11:90868962-90868984 ATGATAAAGCTTACTGAAGAGGG + Intergenic
1086807247 11:91259901-91259923 TTGGTGAAATTTAGTGAAGAAGG + Intergenic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1088506599 11:110533340-110533362 ATAGTTAAGCATATTGCAGAAGG + Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090648856 11:128789110-128789132 ATGTTGAAGCAAAGGGAAGGAGG + Intronic
1091143448 11:133256194-133256216 GTGATGAAGTATAGTGAAGAAGG + Intronic
1091787199 12:3250350-3250372 ATCATGAAGGACAGTGAAGAGGG - Intronic
1092464978 12:8723147-8723169 AAGATTAAGCTTAGTGAAGAAGG - Intronic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093658847 12:21729933-21729955 ATGTTGAAGTATATTTAAGAAGG + Intronic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1095237984 12:39821650-39821672 ATGGTGAACTATACCGAAGAGGG + Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1097788554 12:63788881-63788903 ATAGTTAAGCTTAGTGAGGAAGG - Intronic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099168674 12:79338181-79338203 ATGGTGAAAAATGGGGAAGATGG - Intronic
1099503106 12:83437880-83437902 ATGATTAAGCTTATTGAAGAAGG - Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1101562169 12:105867267-105867289 ATGATTAAGCTTAGTAAAGAAGG + Intergenic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1107101175 13:36594405-36594427 ATAGTGAACCATAGTGCAGAAGG + Intergenic
1107168377 13:37310664-37310686 ATGGTGAAGCAAAGTACAGAAGG + Intergenic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107855236 13:44608637-44608659 ACTGTGTAGCATAGTGTAGAGGG - Intergenic
1108074397 13:46664599-46664621 ATGATGAAGCATTTTAAAGAAGG + Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108701068 13:52944611-52944633 ATGGTTAAGCACAGGAAAGAAGG + Intergenic
1108770635 13:53696384-53696406 ATGATTAAGCTTAATGAAGATGG + Intergenic
1109131283 13:58589389-58589411 ATGATTAATCTTAGTGAAGAAGG + Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109418445 13:62075990-62076012 TTGATGAAGCAAAGTGTAGAAGG - Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1111135132 13:84031787-84031809 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112543886 13:100345187-100345209 ATGATTAAGCTTAGTGGAGAAGG + Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1113722664 13:112572174-112572196 ATGGTTAAGCTTGGTGAGGAAGG - Intronic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG + Intergenic
1114815434 14:25952415-25952437 ATGATTAAGCATAGTAAGGAAGG - Intergenic
1115468579 14:33744172-33744194 ATGATGAAGCTTAGTGAATAAGG - Intronic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1115907660 14:38218882-38218904 AATGTTAAGCATATTGAAGATGG + Intergenic
1115914391 14:38295047-38295069 ATGTTGAAGCTTTGTGAAGACGG - Intergenic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116141688 14:41004135-41004157 ATGATTAAGCTTACTGAAGAAGG + Intergenic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117269596 14:54128628-54128650 ATGATTAAGCTTAGTGATGAAGG + Intergenic
1117456534 14:55902992-55903014 GTAGTGAAGCATAGTGTAGAGGG + Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120544139 14:85789491-85789513 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1120592546 14:86392731-86392753 ATCATTAAGCTTAGTGAAGAAGG - Intergenic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1121766583 14:96492631-96492653 ATAATTAAGCATAGTGAGGAAGG - Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1126075022 15:44900735-44900757 GTGGTGAAGCCTAGTGAGGATGG + Intergenic
1126083344 15:44987087-44987109 GTGGTGAAGCCTAGTGAGGATGG - Intergenic
1126213246 15:46124620-46124642 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
1126240363 15:46435189-46435211 ACGATGAAGCTTAGTGAAGAAGG + Intergenic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1128722593 15:69961734-69961756 ATGATTAAGCATAGTGAGAAAGG + Intergenic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129102436 15:73278666-73278688 ATGGTGAAGCTCTGTAAAGACGG - Intronic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130017442 15:80198552-80198574 CTGCTGAAGCATAGAGGAGATGG - Intergenic
1130301749 15:82684901-82684923 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1131671327 15:94622789-94622811 ATGGCTAAGCATGGTGAAAATGG + Intergenic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1133919102 16:10136117-10136139 ATGGTGGAGCAGAGTGTAAAAGG - Intronic
1133946079 16:10349703-10349725 ATGGAGACACATAGTCAAGAAGG + Intronic
1135730882 16:24894274-24894296 ATGGTGGAGCATGGTGACCAGGG - Intronic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1137378006 16:47970967-47970989 ATGGTCAAGCATATTGAGTAAGG - Intergenic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1137867016 16:51908691-51908713 AGGGTGAAGAATAGTGAAATTGG - Intergenic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140212490 16:72981706-72981728 ATGGTGATGCGTATTGAAGTTGG - Intronic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144661474 17:17073524-17073546 GTGGTGGCGCATAGTCAAGATGG + Intronic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1146087208 17:29840588-29840610 ATGGTGAAGAAAATGGAAGATGG + Intronic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG + Intronic
1149991281 17:61384901-61384923 AGGGTGAAGCCTGGGGAAGAGGG + Intronic
1150662623 17:67096960-67096982 ATGGTTAAGCTTAGTGAAAATGG - Intronic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1152176254 17:78789507-78789529 AGGGTGGAGCCTGGTGAAGAAGG + Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152971947 18:170409-170431 ATGATTAAGCTTAGTAAAGAAGG + Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1155327056 18:24675156-24675178 ATGTTGAAGTATATTAAAGAGGG - Intergenic
1155469978 18:26181529-26181551 ATTGTTAAGCTTAGTGAGGAAGG + Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155671336 18:28375646-28375668 ATGATGAATCATATTAAAGAGGG - Intergenic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1156282416 18:35652765-35652787 AAGGTGAAGTGCAGTGAAGAGGG - Intronic
1156629195 18:38946182-38946204 ATGATGAAGCTTAGCGAGGAAGG + Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158360964 18:56672930-56672952 ATGATGACCCATACTGAAGAAGG + Intronic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159981306 18:74784085-74784107 ATGGTCCAGCATACTGACGAAGG - Intronic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162616612 19:11806317-11806339 ATGGTAACGCACAGTGGAGATGG + Exonic
1164270246 19:23666349-23666371 ATGCTGAAGCAAAGTTAAAAAGG - Intronic
1164789890 19:30967383-30967405 AAGGTTAAACATAGTAAAGATGG + Intergenic
1165125029 19:33588373-33588395 ATGATTAACCTTAGTGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166647700 19:44544291-44544313 ATGGTGAATGATTGAGAAGATGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925578564 2:5385670-5385692 GTAGTGTAGCATAGTGAGGAGGG - Intergenic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925954294 2:8946963-8946985 ATGATTAAGCTTAGTGACGATGG + Intronic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928080564 2:28308885-28308907 ATGGTGAAGCCTACTTGAGAGGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
928852088 2:35760402-35760424 ATGATTATGCTTAGTGAAGAAGG + Intergenic
929097471 2:38277712-38277734 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
929338144 2:40777557-40777579 ATGATTAAGCTTTGTGAAGAAGG - Intergenic
929841099 2:45464182-45464204 ATGGCTAAGGAAAGTGAAGAAGG - Intronic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
935289090 2:101594130-101594152 ATGATGAAGCTTAGTCAGGAAGG - Intergenic
935295195 2:101643474-101643496 ATGGTTAAGCTTTGTAAAGAAGG - Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
938396600 2:130954644-130954666 ATTGTTAATCATATTGAAGAAGG + Intronic
938678628 2:133665261-133665283 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939397810 2:141653797-141653819 AATGTGAAGCATAGAGAAGCAGG + Intronic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941247422 2:163116732-163116754 ATATTGAAGCTTAGTGAATATGG - Intergenic
941433899 2:165444542-165444564 AAGATGAAGCTTAGTGAAGATGG + Intergenic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942430875 2:175910131-175910153 ATGGGAAAGTATAGTGAAGAGGG - Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
943012657 2:182469699-182469721 ATGATGAAGTTTAGTGAAGAAGG - Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943213371 2:184998684-184998706 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943957341 2:194209081-194209103 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
943985793 2:194616459-194616481 ATGATTAAGCTTAGTGAAGCAGG - Intergenic
944449272 2:199824559-199824581 ATGATTAAACTTAGTGAAGAAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
946901307 2:224374488-224374510 ATGGTGCAGCTTAGTGAAGATGG + Intergenic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948438404 2:237968863-237968885 GAGTTGAAGCATATTGAAGAAGG + Exonic
948626286 2:239270421-239270443 ATGGTGAGACACAGTGAAGCAGG + Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
1168972807 20:1942341-1942363 CTGGTCAGGCACAGTGAAGAGGG - Intergenic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169159768 20:3367470-3367492 ATGGTTAAGCTTGGTGAAGGAGG - Intronic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1170849558 20:19992664-19992686 TTAGTGAAGTATAGTTAAGATGG - Intronic
1171279544 20:23884140-23884162 AGGTTGAGGCCTAGTGAAGAAGG - Intergenic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174028872 20:47604346-47604368 TAAATGAAGCATAGTGAAGAGGG - Intronic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1177917503 21:27108190-27108212 ATGGGAAAGGATGGTGAAGAAGG + Intergenic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1181450122 22:23014176-23014198 ATGGTGCAGCTTTGTGGAGAGGG - Intergenic
1181930617 22:26398170-26398192 ATGATTAAGCTTAGTGAAGTAGG - Intergenic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1182761971 22:32729745-32729767 CTAGTGAAGCACAGTGAAAATGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1185262132 22:49873217-49873239 ATGATTAAGCTTAGTGATGAAGG - Intronic
1185353761 22:50353235-50353257 ATGCTTAAGCTTAGTGAAGAAGG - Intronic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949573775 3:5319137-5319159 ATGGGCTAGGATAGTGAAGATGG + Intergenic
949623218 3:5839349-5839371 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949840126 3:8311303-8311325 ATGCTGTGGGATAGTGAAGAAGG - Intergenic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950904491 3:16525377-16525399 ATGGTGAAGGATTGAGCAGAAGG + Intergenic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950976293 3:17249300-17249322 ATGTTGAAGCTTAGTTAGGAAGG - Intronic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951333061 3:21388394-21388416 ATGATGAAGCTTAGTAAGGAAGG + Intergenic
951373324 3:21880693-21880715 ATGATTAAGCTTAATGAAGAAGG + Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
951862405 3:27267827-27267849 ATGATGAAGCTTAGTGAGAAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952256575 3:31700930-31700952 AGGGTGGAGGATGGTGAAGAAGG + Intronic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952653297 3:35752352-35752374 TTGGTGAAGAATTGTGAAGTTGG + Intronic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953808103 3:46089152-46089174 ATGGTGAAGCTTTCTGATGAAGG - Intergenic
955029917 3:55205938-55205960 AGGGTGAAGAATAATGGAGATGG - Intergenic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955222436 3:57034332-57034354 ATGGTGAGTCAAAGAGAAGACGG + Intronic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956608539 3:71098233-71098255 TCAATGAAGCATAGTGAAGATGG - Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
957996735 3:87699408-87699430 AGGATGAAGCTTAGTGAGGAAGG + Intergenic
958091946 3:88887822-88887844 ATGATTCAGCTTAGTGAAGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959013080 3:101100801-101100823 CTAGTGAACCACAGTGAAGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961613164 3:128156925-128156947 ATGATTAAGCTTAGTGATGAAGG + Intronic
961893962 3:130152139-130152161 ATGTTGAAGGATAGTGAGGGAGG + Intergenic
962157414 3:132962803-132962825 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
963195240 3:142520369-142520391 ATGACTAAGCCTAGTGAAGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963608878 3:147440292-147440314 AGTCTGAAGCATAGTGAACAAGG + Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964398807 3:156276991-156277013 ATTATTAAGCTTAGTGAAGAAGG - Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965232013 3:166066236-166066258 TTTGTGAACCAGAGTGAAGAAGG + Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965417105 3:168409761-168409783 ATGGTAAAGCATAGTGTAGTTGG + Intergenic
965438695 3:168685872-168685894 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966175816 3:177136860-177136882 TTAGTGAAGCATAGTAAAGCAGG - Intronic
966494567 3:180565397-180565419 AGGGTTAAACATAGTGAAAAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966814057 3:183874689-183874711 ATAATTAAGCTTAGTGAAGAAGG + Intronic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
968153616 3:196359474-196359496 ATGATGAAGCTTAGTGAGAAAGG + Intronic
969091222 4:4695376-4695398 AGGGAGGAGCATAGTGAAAAGGG + Intergenic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970578815 4:17454338-17454360 ATGATTAAGCTTAGGGAAGAAGG + Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
974212089 4:58791251-58791273 ATGATTAAACTTAGTGAAGAAGG + Intergenic
974270326 4:59642542-59642564 ATGGTGAAACATTCTGAAAAAGG + Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
975501451 4:75090044-75090066 GTGATTAAGCTTAGTGAAGAAGG + Intergenic
976058529 4:81098506-81098528 ATTATTAAGCTTAGTGAAGAAGG - Intronic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
976250826 4:83050489-83050511 ATGGTGAAACCTAGTAAACATGG - Intronic
976505717 4:85844840-85844862 ATGGTGAATCTTAGGGGAGATGG + Intronic
976991563 4:91373734-91373756 ATTATTAAGCTTAGTGAAGAAGG + Intronic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977688333 4:99874767-99874789 ATGATCAAGCTTAGTGAAAAAGG - Intergenic
977715100 4:100173342-100173364 CAAGTGAAGCTTAGTGAAGAAGG - Intergenic
977715102 4:100173382-100173404 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978109381 4:104944293-104944315 ATGGTGTAGCCTAGAGAAAAAGG - Intergenic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978260520 4:106752086-106752108 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979625978 4:122845957-122845979 ATGATTAAGCCTAGTGGAGAAGG - Intronic
979729430 4:124006246-124006268 ATGGTTAAGCTTGGTGAGGAAGG - Intergenic
979759483 4:124383399-124383421 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
979973836 4:127171013-127171035 ATAATTAAGCTTAGTGAAGAAGG + Intergenic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980594765 4:134939386-134939408 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
982222931 4:153140339-153140361 ATGCTTAAGAATGGTGAAGATGG - Intergenic
982344624 4:154343894-154343916 ATGATTAAGCATAGTGACGAAGG - Intronic
982346481 4:154366053-154366075 ATGCTGAAGTATATTGAAAATGG - Intronic
982842030 4:160201090-160201112 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
984021501 4:174489098-174489120 ATTGTGAAACACAGTGAAAAAGG - Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984299378 4:177895348-177895370 ATGATTAAGCTTAGTGATGATGG + Intronic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985345886 4:189003599-189003621 ATTGTTAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986682176 5:10243956-10243978 ATTATTAAGCTTAGTGAAGAAGG - Intronic
986773028 5:10990452-10990474 ATGGTGAACCAAAGAGAAGGGGG - Intronic
987058651 5:14220490-14220512 ATGATTAAACCTAGTGAAGAAGG + Intronic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988008498 5:25451217-25451239 ATGCTGAATGTTAGTGAAGAAGG + Intergenic
989001071 5:36761364-36761386 ATGATTAAGCTTAGTGATGAAGG - Intergenic
989287808 5:39722525-39722547 ATGATTAAGCGTAGTGAGGAAGG - Intergenic
990571894 5:57087324-57087346 ATGATTAAGCTTCGTGAAGAAGG + Intergenic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992426628 5:76664134-76664156 ATTATTAAGCTTAGTGAAGAAGG - Intronic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
992510586 5:77429894-77429916 ATAATAAAGCTTAGTGAAGAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
994844576 5:104970933-104970955 AAGGTGAAGCATAGTGAAAATGG + Intergenic
994900722 5:105765184-105765206 ACGATAAAGCTTAGTGAAGAAGG - Intergenic
995104612 5:108361231-108361253 ATAGTGAAGCGTAGGGAAGTGGG - Intronic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
996464905 5:123788892-123788914 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
997301649 5:132810595-132810617 GTGGGGAAGGATAGGGAAGAGGG - Intergenic
998520803 5:142798755-142798777 AAGGAGAAGCATGGGGAAGAGGG - Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999652602 5:153782369-153782391 ATGATGAAGACTAGTGAACAGGG + Intronic
999793545 5:154966141-154966163 ATGCTGAAGCATAGTAAGCAAGG - Intronic
999882630 5:155883368-155883390 ATGATTAAGCCTAGTGAGGAAGG - Intronic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000657490 5:163898434-163898456 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1001119860 5:168971055-168971077 TTGGTGATTCATAGTAAAGAAGG + Intronic
1001373144 5:171227155-171227177 ATGATTAAGCTTAGCGAAGAAGG + Intronic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1002776023 6:327943-327965 ATGCTGAAGCACTGTGAAAATGG + Intronic
1002856839 6:1045391-1045413 ATGGTCAAGGGTGGTGAAGAGGG + Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1004053412 6:12110848-12110870 ATGATTAAGCTTACTGAAGAAGG - Intronic
1004857189 6:19763256-19763278 ATGATTAGGCATAGTGAGGAAGG + Intergenic
1005117952 6:22358760-22358782 ATTGAGAAGCATAGAGAAAAAGG + Intergenic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006960823 6:37928272-37928294 ATTGTAAAACATAGTAAAGAGGG + Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007688826 6:43684554-43684576 ATTCTGAAGCATAGGGCAGAGGG - Intronic
1007863840 6:44945377-44945399 ATGATTAAGCTTAGTGAAGGAGG + Intronic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009479361 6:64137453-64137475 ATGATCAAGCATCGTGAGGAAGG - Intronic
1009647401 6:66424271-66424293 ATGGTTAAACTTATTGAAGAAGG + Intergenic
1009810911 6:68665039-68665061 AAGGTGAAGCCTGGTGAAGGTGG - Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010608455 6:77921610-77921632 ATCATTAAGCTTAGTGAAGAAGG - Intronic
1010693120 6:78933967-78933989 ATGATTAAGCTTAGTGAAAAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1010790765 6:80062482-80062504 CTTATGAAGCATAGAGAAGACGG - Intergenic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011638015 6:89392551-89392573 ATGATGAGGTATAGTTAAGAAGG - Intronic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1011899606 6:92275605-92275627 ACGGTGCAGCATAGTTTAGATGG + Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1012644620 6:101663493-101663515 ATGATGAAGTATGGTGAAGTAGG + Intronic
1012702556 6:102479116-102479138 ATGATTAAGATTAGTGAAGAAGG - Intergenic
1013202834 6:107917505-107917527 ATGACTAAGCTTAGTGAAGAAGG + Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1013821287 6:114156174-114156196 ATGTGGAAGCTTAGTGTAGAGGG - Intronic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1014319619 6:119910689-119910711 ATGATTAAGATTAGTGAAGAAGG + Intergenic
1014599490 6:123392076-123392098 TTGATGAAGCACAGTGAACAAGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016871584 6:148822737-148822759 AATGTGAAGCATAGTTAATAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1016946185 6:149536360-149536382 ATGATTAAGCATAGTGAGAAAGG + Intronic
1017355197 6:153496880-153496902 ATAGTCAAGCTTAGTGAGGAAGG + Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017622290 6:156311218-156311240 AAGGTGCAAGATAGTGAAGAGGG + Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1019895745 7:3981469-3981491 ATGATGAAGCTTAGTAAGGAAGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1021285361 7:18774897-18774919 ATGATTAAGCTTAGCGAAGAAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022574812 7:31487349-31487371 ATGGTGAAGGAGAGAGCAGAAGG - Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024303865 7:47909853-47909875 CTGGGGAAGAATAGTGAACATGG + Intronic
1024708208 7:51984991-51985013 ATTGTGACACATAGTGAAAAAGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027379256 7:77588202-77588224 ATGATTAAGCTTAGTAAAGAAGG - Intronic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1028311749 7:89347013-89347035 ATTGTGAAGCATAATGATTAAGG - Intergenic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1028695983 7:93713103-93713125 ATGATGGAGCTTAGTGAAAAAGG + Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030352008 7:108500269-108500291 ATGGTGAAAAATAGGGAAAATGG - Intronic
1030839917 7:114336829-114336851 ATGGTGAAATACAGTGAACATGG - Intronic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032999684 7:137490670-137490692 TTGGTTAACCATAGTGTAGAAGG - Intronic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034028181 7:147730730-147730752 ATCATTAAGCTTAGTGAAGAAGG + Intronic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1035796836 8:2365608-2365630 AGGGTGAAGAAAAGGGAAGATGG - Intergenic
1035837826 8:2773622-2773644 CTGGTGAAGTATAGTGAAAGTGG - Intergenic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1038392884 8:27221412-27221434 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042610407 8:70593526-70593548 CAGGTGAAGGAAAGTGAAGAGGG - Intronic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1043313883 8:78895920-78895942 ATGGTGTAGCATTGTGTGGATGG - Intergenic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1044639012 8:94359011-94359033 ATGGTGGAGCATAGGCATGAGGG + Intergenic
1044889491 8:96818018-96818040 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045465594 8:102466723-102466745 ATGATTAGGCTTAGTGAAGACGG - Intergenic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045907808 8:107369562-107369584 ATAATTAAGCATAGTGAAGAAGG - Intronic
1046130328 8:109959730-109959752 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046681477 8:117175308-117175330 ATGGTGAAGCATATTAAAAATGG - Intronic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1046788750 8:118297195-118297217 ATGGTGAGCCATGGTGAACATGG - Intronic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1052499263 9:29268336-29268358 AATGTGCAGGATAGTGAAGATGG - Intergenic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1055039448 9:71853279-71853301 ATTGTTAAGCTTAGTGAGGAAGG - Intergenic
1055040192 9:71862272-71862294 ATGTTGAAACCTAGTGAGGATGG - Intergenic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055486775 9:76763796-76763818 ATGGGGAAGCATGGGGAAGAGGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055873965 9:80920389-80920411 ATGATTAAGCTTAGTAAAGAAGG - Intergenic
1056498118 9:87180266-87180288 ATGGTGAGGCACAGAGAAGGTGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057196022 9:93115934-93115956 AGGGTGAAGGAGAGTGAAGGAGG + Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059690321 9:116678601-116678623 AAGGTTAAGCAAAGTGAAAAGGG + Intronic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061280626 9:129596215-129596237 ATGGTGGAGACTTGTGAAGATGG + Intergenic
1061597112 9:131638117-131638139 ATTGTGAATCCTAGTTAAGATGG - Intronic
1062248381 9:135581917-135581939 TGGGTGAAGCACAGTGGAGATGG + Intergenic
1185884706 X:3772103-3772125 ATGGTGAAGCAAAGTGTTAATGG + Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187474448 X:19598539-19598561 ATGATCGAGCTTAGTGAAGAAGG - Intronic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1187840528 X:23482407-23482429 ATGTTGAATCATAGAGACGATGG - Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189060140 X:37744981-37745003 ATGATTAAGTTTAGTGAAGAAGG - Intronic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189837328 X:45039191-45039213 ATGGGGAGGCAAAGTGCAGATGG - Intronic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190438531 X:50452422-50452444 AGGTAGAAGCCTAGTGAAGAAGG - Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190486624 X:50932637-50932659 ATGATTAAGCTTAGTGAAGGAGG + Intergenic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1193304732 X:79934650-79934672 GTGGTGATGGATAGTGATGATGG + Intergenic
1193426826 X:81349624-81349646 ATGGTGATGCATGGTGGAGAAGG + Intergenic
1194260896 X:91694344-91694366 ATGTTTAAGCTTAGTAAAGAAGG - Intergenic
1194293765 X:92104684-92104706 AGGTGGAAGCATAGTGAAGGAGG + Intronic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1194853107 X:98892973-98892995 ATGTTGAAGCTTACTGAATACGG + Intergenic
1194940228 X:100000321-100000343 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198056647 X:133002297-133002319 GTGGTGTGGCATAGAGAAGAGGG + Intergenic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198840833 X:140855939-140855961 ATGGTGAAGCATAGTGCTGTAGG - Intergenic
1198883743 X:141310384-141310406 ATGATTAAGCTTAGGGAAGAAGG - Intergenic
1199161116 X:144613301-144613323 ATGATGAAGCATGCTGAAGTGGG - Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1199359262 X:146898568-146898590 ATGATAAAGCTTAGTGAAGGAGG + Intergenic
1199926939 X:152477523-152477545 ATGGTGAATAGTAGTGATGATGG - Intergenic
1200579547 Y:4933146-4933168 ATGTTTAAGCTTAGTAAAGAAGG - Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201318498 Y:12671688-12671710 AAGGTAAAGCATAATGAAAAAGG - Intergenic