ID: 987799068

View in Genome Browser
Species Human (GRCh38)
Location 5:22669514-22669536
Sequence GCTTTTCTTGCAACTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987799065_987799068 -3 Left 987799065 5:22669494-22669516 CCAAAAGGCTACGTTTCCTGGCT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG 0: 1
1: 0
2: 2
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987799068 Original CRISPR GCTTTTCTTGCAACTAAAGG TGG Intronic
900937339 1:5774747-5774769 GCTATTTTTGCCACGAAAGGAGG - Intergenic
907282168 1:53357060-53357082 GCCTTTCTTGTAATTAAATGTGG + Intergenic
908381869 1:63604548-63604570 GCCCTTCTTGCAAGTAAATGTGG - Intronic
910275067 1:85440842-85440864 GTATTTCTTCCAACTAAAGCTGG + Intronic
912687187 1:111776869-111776891 GGTTTCCTTGCAAGGAAAGGAGG + Intronic
913374682 1:118137873-118137895 CCTTTTCTTGCAGCTGAAGATGG + Intronic
916388167 1:164300452-164300474 GAATTTCTTTCAACTAAATGAGG + Intergenic
916990809 1:170242854-170242876 GCTTCCTTTGCAACTATAGGTGG + Intergenic
921278731 1:213544668-213544690 GCTTTGCTTGCATCTCATGGTGG + Intergenic
1063977116 10:11426423-11426445 ACTTCTCTTGCAACTACAGGTGG + Intergenic
1064213057 10:13377015-13377037 GCTTTTCTTGCAGCTAAGAAAGG - Intergenic
1064420180 10:15184294-15184316 GCTTCTCTTGCAGCTAGAGGTGG + Intergenic
1067268941 10:44773147-44773169 GCCTTTCCAGCATCTAAAGGTGG + Intergenic
1069087373 10:64157045-64157067 ATTTTTATTGCAACTAAAAGAGG - Intergenic
1072856329 10:98951425-98951447 CCTTTTCTTGCATGCAAAGGAGG - Intronic
1072893026 10:99341739-99341761 GCTTTTCTTCCAGCAAAATGGGG + Intronic
1073676169 10:105649431-105649453 GCTTCTCTTGCATTCAAAGGTGG - Intergenic
1073874575 10:107907285-107907307 GCTTTTCTTGTACCTGAGGGGGG - Intergenic
1080234010 11:30047871-30047893 GCTATTCTTGCAACTGGATGTGG + Intergenic
1082324720 11:51125068-51125090 GCTTTTCTTGAATCTGCAGGTGG + Intergenic
1085056398 11:73406653-73406675 TCTCTTCTTGCAAATAGAGGTGG + Exonic
1091056368 11:132423091-132423113 GGTTTTCTTTCAACTGAAGAAGG - Intronic
1092146928 12:6221264-6221286 GCTTTTCTTGGAAACAAAAGAGG + Intronic
1093363035 12:18255684-18255706 GCCTTTCTTTCAACTAGATGTGG - Intronic
1097074168 12:56380283-56380305 GCTCATCTTGAAACTAAAGCGGG - Intergenic
1097592663 12:61591153-61591175 GCTTTACTTCCAAAGAAAGGTGG + Intergenic
1097690758 12:62732460-62732482 GCTTTTCTTGCTAGTGAAGAAGG - Intronic
1100228479 12:92583118-92583140 GCTATTGTTGGAACAAAAGGAGG + Intergenic
1100641099 12:96483070-96483092 GCTATTTTTGCAAGTATAGGGGG - Intergenic
1101869236 12:108549454-108549476 GGTTCTCTTGGAAATAAAGGAGG + Intronic
1102420426 12:112799043-112799065 GCTTTGCTTGGAGCTGAAGGGGG + Intronic
1104369114 12:128207091-128207113 GCTTTTCCTGCAAGTAGAGTGGG + Intergenic
1106990420 13:35412780-35412802 GCTTTTCTTGCAGTTAGAAGCGG + Intronic
1110017093 13:70420111-70420133 GCTTTTATTCCAACTAAGGAAGG - Intergenic
1110191011 13:72728276-72728298 GCATTACTTGCAATCAAAGGAGG - Intronic
1110242251 13:73282339-73282361 GCTTCTCCTGCAACTCAGGGTGG - Intergenic
1110437532 13:75492194-75492216 GCCTGTCTTGAAACTAATGGTGG + Intergenic
1112600809 13:100854223-100854245 GCTGTTCTTGCAAATCAAAGCGG + Intergenic
1113180898 13:107624805-107624827 GCTTATCTTCCTAATAAAGGAGG + Intronic
1115270075 14:31541632-31541654 GCTTACCTTGTAACTAAGGGTGG + Intronic
1115648735 14:35388075-35388097 GCTTATTTTGCAAATAAAGCTGG + Intergenic
1116413926 14:44658160-44658182 CCTTTGCTTACAAATAAAGGAGG - Intergenic
1117779053 14:59213523-59213545 GCTATTCCTAAAACTAAAGGAGG + Intronic
1123500138 15:20874483-20874505 GCTGCTCTTGCAACTAAAAGTGG - Intergenic
1123557386 15:21448183-21448205 GCTGCTCTTGCAACTAAAAGTGG - Intergenic
1123593611 15:21885434-21885456 GCTGCTCTTGCAACTAAAAGTGG - Intergenic
1124849242 15:33319985-33320007 GCTTTATTTGCAAATAGAGGCGG + Intronic
1126562147 15:50055635-50055657 GCCCTTCTTGCCACAAAAGGAGG + Intronic
1127615856 15:60684796-60684818 GCTTTTCTAGGAATTAAAGGAGG - Intronic
1128628612 15:69239138-69239160 GCTTCCCTTGCAGCTAGAGGTGG + Intronic
1128811862 15:70578754-70578776 GGTCTCCTTGCAACTCAAGGGGG + Intergenic
1128811948 15:70579442-70579464 GGTCTCCTTGCAACTCAAGGGGG + Intergenic
1131858658 15:96627390-96627412 GCTTTTCTTATAACAAAAGCAGG - Intergenic
1202965732 15_KI270727v1_random:175356-175378 GCTGCTCTTGCAACTAAAAGTGG - Intergenic
1137992268 16:53170905-53170927 GCTTTTCTTGCAACTCAGGAAGG + Intronic
1138542444 16:57696484-57696506 GATTCTCTTGCAGCTAGAGGTGG - Exonic
1141257465 16:82415924-82415946 CATTTTGTTGCAACTAATGGAGG + Intergenic
1144120162 17:12144672-12144694 GGTTTTCTTGTATCTAAAAGGGG - Intergenic
1144515398 17:15914167-15914189 TTTTTTCTTCCAACTATAGGTGG - Intergenic
1144660580 17:17066569-17066591 GTATCTCTTGCAAATAAAGGGGG - Intronic
1146819000 17:35969483-35969505 GCTTTCCTTCCCACTAAAAGTGG - Intergenic
1149341465 17:55690766-55690788 GCCTTTCTTGCAGCTTATGGTGG + Intergenic
1149437799 17:56648509-56648531 GTTTTGCTTGCAAATATAGGTGG + Intergenic
1154458746 18:14557408-14557430 GCCGCTCTTGCAACTAAAGGTGG - Intergenic
1155051947 18:22156269-22156291 GATTTTTTTGCAATTAAGGGGGG - Intergenic
1156216100 18:34999768-34999790 GCGTATCTGGCAAGTAAAGGAGG - Intronic
925114515 2:1367076-1367098 TGTTTTCTTGCACCTAACGGGGG - Intronic
926376634 2:12235415-12235437 GCTTTCCTTGTAACTAGATGTGG + Intergenic
927031937 2:19129466-19129488 GATTTTCTTGCAACAAAATATGG + Intergenic
928662366 2:33516072-33516094 TATTTCCTTGCAAGTAAAGGTGG - Intronic
932607919 2:73176773-73176795 ACTTTTCTTTCAAAGAAAGGCGG + Intergenic
933571767 2:84022278-84022300 GATTTCCTTGCAGCTACAGGAGG - Intergenic
939136765 2:138305522-138305544 ACTTCTCTTGCAACTAGAGGAGG - Intergenic
939210658 2:139171335-139171357 GATTTCCTTGCAATTAAATGAGG + Intergenic
939383526 2:141466494-141466516 GTCTTTCTTGCAAATAAGGGTGG + Intronic
939681146 2:145134746-145134768 GCTTTGCTTGGGACAAAAGGAGG - Intergenic
940605110 2:155913079-155913101 GCTTTTCTTACAATAAGAGGAGG + Intergenic
940746741 2:157575650-157575672 GCTACTCTTGCAGCTAAATGTGG - Intronic
941351960 2:164448523-164448545 CCTTTTCTGGCAATAAAAGGAGG - Intergenic
942410016 2:175699449-175699471 GCTTCTCTTGCAAATAGATGTGG + Intergenic
942410657 2:175705876-175705898 GCTTCTCTTGCAACTAGATGTGG + Intergenic
942701627 2:178717777-178717799 AGTTTTCTTGCAAAGAAAGGTGG + Exonic
946437099 2:219664458-219664480 GCTTTTCTAGCCACTCAAGGGGG + Intergenic
1171008859 20:21495749-21495771 GGTTTTCTTTCAACTGATGGAGG - Intergenic
1173180484 20:40803096-40803118 GCTTTCCTTGCAGCTAGATGGGG - Intergenic
1173441478 20:43080664-43080686 GCTCTTCTTGCATGTAGAGGTGG + Intronic
1175080862 20:56419244-56419266 CCTTTTTTTGCAACTCAAGTTGG - Intronic
1175401864 20:58705252-58705274 GTTTTTCTTTCAAGTAAAGATGG + Intronic
1175515364 20:59566615-59566637 ACTTTTCTGGCAACCACAGGCGG + Intergenic
1176815401 21:13595913-13595935 GCTGCTCTTGCAACTAAAGGTGG + Intergenic
1177660208 21:24073070-24073092 GCATTTGCTGCAGCTAAAGGAGG + Intergenic
1179299184 21:40091064-40091086 GCCTTTCTTACAACTAATGGCGG - Intronic
1179515644 21:41904554-41904576 CCTTTTCTGGTAACGAAAGGAGG + Intronic
949117140 3:340249-340271 GCTCTTTTTGCAACTTAAAGTGG + Intronic
950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG + Intergenic
951872263 3:27377077-27377099 GTTTTTCTTACAACTAAAGAGGG + Intronic
955682988 3:61521562-61521584 ACTTTTCCTGGAACTAAAAGGGG - Intergenic
956649913 3:71495116-71495138 GCCTTGCTTGAAACAAAAGGAGG - Intronic
957760599 3:84550098-84550120 GCTTTTCTTGGAAGCCAAGGTGG - Intergenic
957836874 3:85605688-85605710 GCTTTTCTTACAATTACAGGTGG - Intronic
958596672 3:96234468-96234490 GCTTATCTTCCTACTAGAGGTGG + Intergenic
958623323 3:96591831-96591853 ACTTTTATTGCAATTAATGGTGG - Intergenic
959704639 3:109328854-109328876 GCTTTTCTACAAACTAAAAGTGG - Intronic
960142923 3:114168452-114168474 GCTTCCTTTGCAGCTAAAGGTGG + Intronic
963423669 3:145095319-145095341 GCTTTTCTTGGATCTCAAGTAGG + Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
964766813 3:160187364-160187386 GCCTTTCTTGCAATTAACAGTGG - Intergenic
966135978 3:176698599-176698621 GCTCCTCTTGAAAGTAAAGGAGG + Intergenic
967301804 3:188021596-188021618 GCTTTTCTTCCAGCTCATGGTGG - Intergenic
969520118 4:7672791-7672813 GCTTTCTTTGCAACTACATGTGG + Intronic
970436570 4:16041469-16041491 ACTTTTCTTCCAAGTAAAGATGG - Intronic
972105504 4:35480604-35480626 TCTTTACTTGCCACTAAAGCAGG + Intergenic
975323902 4:73038588-73038610 GTTTTTCTTCCACCTAAAGTAGG + Intergenic
975508957 4:75171177-75171199 GGTTTTCTTGAGACTATAGGAGG - Intergenic
982105281 4:152006516-152006538 GCTTCTCTTGAAACTAGAGATGG + Intergenic
982769472 4:159382878-159382900 AATTTTCTTACAAATAAAGGCGG + Intergenic
983080741 4:163382260-163382282 GCTCTTCTTCAAACTGAAGGTGG + Intergenic
985219410 4:187687466-187687488 GCCTTGCTTGAAACTAAATGTGG + Intergenic
986956413 5:13156129-13156151 GCCTACCTTGCAGCTAAAGGTGG + Intergenic
987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG + Intronic
987955863 5:24739070-24739092 CCTTTTCTTCCAACTAAACAAGG + Intergenic
988607352 5:32690211-32690233 GCCTCTCTTGAAACTAAGGGAGG - Intronic
990277382 5:54212483-54212505 GCTTCTCTTACAACTAGATGTGG - Intronic
990875419 5:60478974-60478996 GCTATGCTTGCCACAAAAGGAGG - Intronic
992558249 5:77924409-77924431 GCTTTTGTGGGAACTAAATGAGG - Intergenic
993592859 5:89816843-89816865 GCTTCCCTTGCAGCTAGAGGTGG + Intergenic
994551985 5:101246484-101246506 TCATGTCTTGCAAATAAAGGAGG - Intergenic
995578134 5:113563454-113563476 GCATTTCTTACAATTAAAGCTGG - Exonic
995587426 5:113662531-113662553 ACTTTTCTTCCAATGAAAGGTGG + Intergenic
999396237 5:151230380-151230402 GCTTTCCTTGCATCTAGGGGTGG + Intronic
1000961087 5:167602050-167602072 GCTTTTCTTGCCAGGAAACGTGG + Intronic
1000992412 5:167924523-167924545 GCACTTCTTTCAACTCAAGGTGG + Intronic
1003743583 6:8972281-8972303 GTTATTCCTGCAACTTAAGGTGG - Intergenic
1004744516 6:18496738-18496760 TCTTTTCTTCCAAGTAAAGCCGG + Intergenic
1006491967 6:34395335-34395357 CCTTTTCTTGCATCTTAAGGTGG - Intronic
1006623207 6:35381684-35381706 GCCTCCCTTGCAACTAATGGAGG - Intronic
1006822240 6:36906283-36906305 GCTTATTTTGCAAATAAAAGAGG - Intronic
1010063701 6:71655394-71655416 GTTTTTATTGCAATTAAAAGAGG + Intergenic
1011627290 6:89293824-89293846 GCATTTCTCCCAACAAAAGGAGG + Intronic
1012625345 6:101398707-101398729 TTCTTTCTTGCAACTCAAGGCGG + Intergenic
1015930313 6:138352974-138352996 GCTTTACTTGAAACTAAATTTGG - Intergenic
1017837065 6:158188177-158188199 GCTTTCCTTGCAAACAAGGGAGG - Intronic
1019835671 7:3380905-3380927 GGTTTCCTTGCAGCTAAAGACGG - Intronic
1021290651 7:18840103-18840125 TCTTTTCTTGAAATTAAAAGGGG - Intronic
1022103337 7:27182108-27182130 GCTTTTCTTTCTACCAAATGAGG - Exonic
1023620946 7:42071887-42071909 GCTGTTCTTCCCACTAAAAGTGG - Intronic
1024385918 7:48751424-48751446 TCTTTTCTTGCAACCCAAAGAGG + Intergenic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1028480992 7:91304359-91304381 GCATTTTCTGCAACTAAAGATGG + Intergenic
1028878937 7:95857214-95857236 GCTATTGCTGCAACTAAAGGAGG - Intronic
1030872991 7:114780689-114780711 TCTTTTCTTGCTACCCAAGGTGG - Intergenic
1030990427 7:116292265-116292287 GAGTTTCTTGGAACTAGAGGAGG - Intronic
1033251675 7:139765926-139765948 GCTTTTCTTGAAAGATAAGGTGG - Intronic
1033881804 7:145893561-145893583 GCATTTCTTGCATCTATAGAAGG - Intergenic
1034590058 7:152131192-152131214 GCTTTCCTTTCACCTGAAGGTGG - Intergenic
1035941855 8:3910135-3910157 GCTTTTCTTACAACTTATGTCGG + Intronic
1041175825 8:55194880-55194902 GCTTTTCATAAAATTAAAGGAGG + Intronic
1042097182 8:65229648-65229670 GGTTGTCATGCAACAAAAGGTGG - Intergenic
1042250284 8:66749592-66749614 GCTTTTCTTTGAATTTAAGGAGG + Intronic
1046492701 8:114973451-114973473 GCATTTCTTGCATCTAGATGTGG - Intergenic
1047397650 8:124516782-124516804 GTTTTTCTAGCAAGTAAATGAGG + Intronic
1047674547 8:127185853-127185875 GCTTCTCTTGCAATTAATTGTGG - Intergenic
1049118580 8:140712947-140712969 GCTGTTCTTTCAAGTAAAGCTGG + Intronic
1050560685 9:6831851-6831873 GCTTCTCTTGCAGCTAAGGATGG - Intronic
1050723576 9:8620019-8620041 GCTTTACTGACTACTAAAGGGGG - Intronic
1055759399 9:79590594-79590616 GCTCTGCTTACAACTAAAGCAGG - Intronic
1061232068 9:129320891-129320913 TTTTTTTTTGCAACTAGAGGGGG + Intergenic
1203531958 Un_GL000213v1:153528-153550 GCTGCTCTTGCAACTAAAGGTGG - Intergenic
1188413334 X:29901220-29901242 GCTTCTCTTGCAGCTACATGTGG - Intronic
1188849912 X:35119308-35119330 GCTTTTATAGCTAATAAAGGTGG - Intergenic
1194265171 X:91744197-91744219 GCTTTTCTGGGCACTAAGGGAGG - Intergenic
1195447296 X:104968741-104968763 GTTTTTCTTGCAATTATACGCGG - Intronic
1197019977 X:121675195-121675217 GTTGTTCTTGCAGCTAGAGGGGG + Intergenic
1200582323 Y:4964643-4964665 GCTTTTCTGGGCACTAAGGGAGG - Intergenic