ID: 987805962

View in Genome Browser
Species Human (GRCh38)
Location 5:22769083-22769105
Sequence CCTCTTAGTAACCATCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987805962_987805967 0 Left 987805962 5:22769083-22769105 CCCCAGTGATGGTTACTAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 140
Right 987805967 5:22769106-22769128 TGTCAACTTGATTGAATTGAGGG 0: 84
1: 1725
2: 1743
3: 1023
4: 805
987805962_987805966 -1 Left 987805962 5:22769083-22769105 CCCCAGTGATGGTTACTAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 140
Right 987805966 5:22769105-22769127 GTGTCAACTTGATTGAATTGAGG 0: 4
1: 116
2: 191
3: 282
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987805962 Original CRISPR CCTCTTAGTAACCATCACTG GGG (reversed) Intronic
900879517 1:5370652-5370674 CCTGATATTAACCATCACAGGGG - Intergenic
902244989 1:15114927-15114949 CCTCAGAGTGACCGTCACTGTGG + Exonic
902271010 1:15305036-15305058 CCTCTTAATAACAATCACACTGG + Intronic
907353592 1:53853778-53853800 CCTTTTAGTAACCATCAACTTGG + Intronic
916242779 1:162656787-162656809 CCTTTCAGAAACTATCACTGTGG + Intronic
919964631 1:202510296-202510318 CCTGTCAGTAGCAATCACTGGGG + Intronic
921102809 1:211945139-211945161 CCTCCTTCTAAACATCACTGTGG + Intronic
921756417 1:218862031-218862053 CCTCTTAGTAGCCATTGCTTTGG - Intergenic
923524372 1:234760671-234760693 CCTCTGAGCAACCTGCACTGTGG - Intergenic
923777256 1:236990668-236990690 CCTCTTCTTCACCATCCCTGGGG + Intergenic
1064677152 10:17772480-17772502 CCTTTTAAGAAACATCACTGCGG + Intronic
1065394130 10:25216069-25216091 CCTTTCATTAACCATCACTGAGG + Intronic
1067044891 10:42980010-42980032 CCTCTTTGTTGCCATCCCTGTGG + Intergenic
1067422161 10:46161402-46161424 ACTCTCAGTTACCATCATTGTGG - Intergenic
1067507467 10:46867499-46867521 ACTCTCAGTTACCATCATTGTGG - Intergenic
1071208246 10:83308987-83309009 TCTTGTAGTAACAATCACTGAGG - Intergenic
1071950441 10:90697442-90697464 CCTCCTAGAAAGGATCACTGTGG - Intergenic
1074045417 10:109833526-109833548 CCTCTAGGAAACCATCTCTGAGG + Intergenic
1079175846 11:18139653-18139675 CCTCAGATTAACCCTCACTGAGG + Intronic
1079179398 11:18175715-18175737 CCTCAGATTAACCCTCACTGAGG + Intronic
1079899195 11:26160262-26160284 CCTCTAAGCAACCATCATTCAGG - Intergenic
1080439420 11:32277468-32277490 CCTCTAAATATCCAACACTGTGG - Intergenic
1080527112 11:33133837-33133859 CCTCTTAGTCTCCTTCAATGTGG - Intronic
1090609389 11:128456650-128456672 CCCCTTAGTAACCAGGCCTGTGG + Intergenic
1091111358 11:132971957-132971979 CCTCTTGGCAAGCATCAATGTGG + Intronic
1096743652 12:53712081-53712103 CCTGTCAGAAACCAGCACTGGGG - Exonic
1101103877 12:101421500-101421522 ACTCTTAGTAATCAGCAGTGAGG + Intergenic
1103622184 12:122194237-122194259 CTTCTTAGTTACCATTTCTGGGG + Intronic
1107817833 13:44260019-44260041 ACTTTTAATAACCATCACTCTGG - Intergenic
1109455500 13:62583022-62583044 CCTCTTACAAAGCATCAGTGGGG - Intergenic
1109516939 13:63456139-63456161 CCTCTTAGTTTCCACCACTAGGG - Intergenic
1112241424 13:97685418-97685440 CCAGTTAGTACCCATCAGTGAGG + Intergenic
1116524858 14:45891858-45891880 CCTCTTAGCAACCGGCTCTGCGG - Intergenic
1119315857 14:73694015-73694037 CCTCTTGGAAGGCATCACTGAGG + Intronic
1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG + Intronic
1120715466 14:87836577-87836599 CCTTTTAGTAACAAAGACTGAGG - Intergenic
1121486347 14:94319119-94319141 TCTGTTAGTAGCCATCCCTGTGG - Intronic
1122202561 14:100131398-100131420 CCACCCAGTAGCCATCACTGAGG - Intronic
1126467764 15:48976226-48976248 CCGCTTAGTATCCAGCACTGAGG - Intergenic
1126737838 15:51750191-51750213 CCTCTTATTAACTATCATTGGGG + Intronic
1129415768 15:75378262-75378284 CCTTTAAGAAACTATCACTGGGG + Intronic
1130771690 15:86930495-86930517 CCTCTAAGTAAGCATCTCAGAGG - Intronic
1131551465 15:93360757-93360779 CCTCTTAGAAAACACCCCTGAGG + Intergenic
1134613892 16:15634225-15634247 CTTGGTAGTAACCAACACTGAGG + Intronic
1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG + Intronic
1136714869 16:32270325-32270347 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136753049 16:32659411-32659433 ACTGTTAAAAACCATCACTGGGG + Intergenic
1136815064 16:33210953-33210975 ACTGTTAAAAACCATCACTGGGG - Intronic
1136821540 16:33321033-33321055 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136828103 16:33377572-33377594 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136833169 16:33476343-33476365 ACTGTTAAAAACCATCACTGGGG - Intergenic
1137711222 16:50568198-50568220 CCTTTTCTTAACCATCTCTGGGG + Intronic
1138066743 16:53949311-53949333 CCTCTATGTGACCATCAGTGTGG - Intronic
1139517082 16:67458473-67458495 CCTCTCAGTGGCCATCACTGAGG - Intronic
1202993641 16_KI270728v1_random:33928-33950 ACTGTTAAAAACCATCACTGGGG - Intergenic
1203055184 16_KI270728v1_random:919444-919466 ACTGTTAAAAACCATCACTGGGG + Intergenic
1146589813 17:34119078-34119100 CCACTGAGTAGCCATGACTGGGG - Intronic
1147330549 17:39696529-39696551 CCTCTTGGTACCCTTGACTGGGG + Intronic
1149811076 17:59672780-59672802 GTTCTTAGTGGCCATCACTGGGG + Intronic
1150910762 17:69385045-69385067 CTTGATTGTAACCATCACTGTGG + Intergenic
1152206438 17:78976968-78976990 CCTCCAAGTCATCATCACTGGGG + Intronic
1156224297 18:35088071-35088093 CCTCTTAATTACCATCACAATGG + Intronic
1157762735 18:50276118-50276140 CTGGTTAGTCACCATCACTGAGG + Intronic
1158123816 18:54080152-54080174 CCTAATATTAACCATCACAGGGG + Intergenic
1163494253 19:17636058-17636080 CCTCATAGTGTCCATCATTGAGG - Exonic
1164921279 19:32090382-32090404 CCTTTTAGTAACTATCTCTTGGG - Intergenic
1166024634 19:40070354-40070376 CAACTTAGTAACCATGACTCTGG + Intronic
1166439473 19:42799103-42799125 CATCTCAGTAACCATCATTTTGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
931570668 2:63666028-63666050 CCTCAGAGTAACAATCACTATGG - Intronic
932988812 2:76761382-76761404 CCTCTTAGTTACCATCAATTTGG + Intronic
933037264 2:77415831-77415853 CCTCTTATATACCAACACTGTGG - Intronic
938626767 2:133118445-133118467 CCGTTTAATAACCCTCACTGTGG - Intronic
940704777 2:157090570-157090592 CCTCTTAATAGCCATCATTAGGG + Intergenic
944816573 2:203383311-203383333 CATCTTACTCACCATGACTGAGG - Intronic
946528987 2:220551044-220551066 CCTCCTAATAACCATCACTTTGG + Intergenic
1170152281 20:13238161-13238183 CCATTTAATAAACATCACTGTGG + Intronic
1171953908 20:31444767-31444789 CATCTTTGTAACCACCACTCAGG + Intronic
1172396267 20:34608040-34608062 CCTTTTAGTGAGCATCACTATGG + Intronic
1177232732 21:18343306-18343328 CCTATTAAAAACCATCATTGAGG - Intronic
1182486843 22:30644296-30644318 CCTATGAGTAAGCATCTCTGTGG + Intronic
1183670771 22:39271143-39271165 ACTCAAAGTACCCATCACTGTGG + Intergenic
1184989417 22:48156897-48156919 CCTCCTAATTACCATCACAGTGG - Intergenic
1185023052 22:48391610-48391632 GCACTTAGAAACCATCACAGCGG - Intergenic
952080776 3:29754905-29754927 CCCCTGAGTAGCCATGACTGGGG - Intronic
952203507 3:31155828-31155850 CCATCTATTAACCATCACTGTGG + Intergenic
952329201 3:32348387-32348409 CCTCTAAGTACCCAGCACAGTGG - Intronic
954282369 3:49591151-49591173 CCTCTTATTTACCATTCCTGTGG + Intronic
966959336 3:184917960-184917982 CCTCCTAATAACCATCACATTGG + Intronic
969923812 4:10566090-10566112 CATCATAGTCATCATCACTGTGG + Exonic
971404305 4:26307239-26307261 ACTCATAGTTACCGTCACTGTGG + Intronic
971981965 4:33763376-33763398 CCTAATATTAACCATCACAGTGG - Intergenic
974688713 4:65267357-65267379 CCTCTTCCTTACCTTCACTGTGG - Intergenic
975560275 4:75702569-75702591 CCTCTTAGTTTCCATTCCTGGGG - Intronic
977048753 4:92099984-92100006 CCTCTTAGGAGCCAGCACTTGGG + Intergenic
979359969 4:119750434-119750456 CCTCTGTGTAACCAACAGTGTGG - Intergenic
980380169 4:132003563-132003585 CCTCCTAGTCTCCAGCACTGTGG - Intergenic
982726795 4:158914998-158915020 CCACTGAATAAACATCACTGTGG + Intronic
983095149 4:163552659-163552681 CCTCGTTGAATCCATCACTGAGG + Intronic
984359915 4:178716088-178716110 CCTCTGTGTAACCAGCACTTTGG + Intergenic
985540747 5:486302-486324 CCTCCTAGGAACCGTCAGTGAGG - Intronic
985822755 5:2171124-2171146 CCTCTTTTTAAGCATGACTGCGG + Intergenic
986759123 5:10863901-10863923 CCTCGTAGCAACCACCACGGGGG + Intergenic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
989563220 5:42874801-42874823 CCTGCTAGTAGCCAACACTGAGG + Intronic
990052714 5:51527519-51527541 CCTTTTAGTAGCCATAACAGTGG + Intergenic
991105242 5:62835598-62835620 TCTCTTAGTCACCATCATTTTGG - Intergenic
993712215 5:91236754-91236776 ACTCTTAGTTACCATCATTCTGG + Intergenic
995325661 5:110886969-110886991 ACTCTTAGTTACCATCATTTTGG - Intergenic
995584681 5:113636133-113636155 CCTAATATTAACCATCACAGTGG - Intergenic
1003681522 6:8262180-8262202 TGTCTTAGTAAACCTCACTGGGG - Intergenic
1008617476 6:53240507-53240529 CCACTTAGAAGCCATTACTGAGG + Intergenic
1009906163 6:69872277-69872299 CCACTATGTAACAATCACTGGGG - Intronic
1016255615 6:142101799-142101821 ACTCTCAGTTACCATCACTTTGG + Intergenic
1017218559 6:151938739-151938761 CTACTTAGTAACAATCAATGTGG - Intronic
1018728874 6:166634261-166634283 CCTCTTGCTCTCCATCACTGTGG - Intronic
1021279744 7:18702793-18702815 ACTCTTTGCAACCAACACTGCGG + Intronic
1022914784 7:34937174-34937196 CAGCTTAGTAAACATCTCTGTGG + Intronic
1027707675 7:81554878-81554900 ACTCTTAGTTACCATCATTTTGG - Intergenic
1030472383 7:109981224-109981246 TCTTTTAGAAACCATCATTGTGG + Intergenic
1030647251 7:112075395-112075417 CCTCTTCATTACCATCAGTGTGG - Intronic
1031779055 7:125939602-125939624 GCTCTCAGTAACCTCCACTGTGG - Intergenic
1039417646 8:37409401-37409423 CCTCATATTAACCATCATGGAGG - Intergenic
1040089354 8:43380889-43380911 ACTCTTAGTTGCCATCACTTTGG + Intergenic
1040402762 8:47069058-47069080 ACTCTCAGTTACCATCACTTTGG - Intergenic
1041633356 8:60113866-60113888 TCTCTTAGTAACCAGGACTTTGG - Intergenic
1043001816 8:74768808-74768830 CCTAATATTAACCATCACGGAGG + Intronic
1045596864 8:103666834-103666856 ACTCTTAGTTACCATCATTTAGG + Intronic
1046487184 8:114902128-114902150 ACTCTTAGTTACCATCATTTTGG - Intergenic
1046648252 8:116809130-116809152 CCTCTTTGTCTCCATCACTTTGG + Intronic
1047488882 8:125357851-125357873 CCTCTGAGTAACTACCACTAGGG - Intronic
1049113571 8:140665988-140666010 CTTCTTATAAACCATCAATGTGG - Intronic
1050145689 9:2565002-2565024 CCTCTGAGTAACCATTCTTGAGG + Intergenic
1050799799 9:9595977-9595999 CCTATTAGTATCCATCACAAGGG + Intronic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1060749563 9:126160061-126160083 CATGTTCTTAACCATCACTGTGG + Intergenic
1061233901 9:129331245-129331267 TGCCTTAGTAACCATCACTTTGG + Intergenic
1186811289 X:13191317-13191339 CCTAATATTAACCATCACGGGGG - Intergenic
1188073229 X:25743642-25743664 ACTCTTAGTTACCATCATTTTGG + Intergenic
1189239556 X:39515167-39515189 CCACTGTGTAACCAGCACTGAGG - Intergenic
1189343384 X:40221591-40221613 CATCTCAGAAACTATCACTGTGG - Intergenic
1195479065 X:105321918-105321940 ACACTTAGCAACCATGACTGGGG + Intronic
1195558671 X:106257546-106257568 ACTCTTAGTTACCATCATTTTGG + Intergenic
1196086755 X:111691796-111691818 TCTATGAGTAGCCATCACTGTGG - Intronic
1196967888 X:121077972-121077994 ACTCTTAGTTACCATCATTTTGG + Intergenic
1197554173 X:127934350-127934372 ACTCTCAGTTACCATCACTTAGG - Intergenic
1199369035 X:147022974-147022996 CCACTTAGTAGCCATCGCTTTGG + Intergenic