ID: 987811419

View in Genome Browser
Species Human (GRCh38)
Location 5:22840960-22840982
Sequence AAGAACAAGGGGAAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 558}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987811413_987811419 12 Left 987811413 5:22840925-22840947 CCAGGAAAAGCAAGAAGAGTTGG 0: 1
1: 1
2: 2
3: 46
4: 307
Right 987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG 0: 1
1: 0
2: 4
3: 46
4: 558
987811412_987811419 20 Left 987811412 5:22840917-22840939 CCTAAGTTCCAGGAAAAGCAAGA 0: 1
1: 0
2: 2
3: 48
4: 363
Right 987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG 0: 1
1: 0
2: 4
3: 46
4: 558
987811411_987811419 23 Left 987811411 5:22840914-22840936 CCTCCTAAGTTCCAGGAAAAGCA 0: 1
1: 0
2: 2
3: 20
4: 218
Right 987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG 0: 1
1: 0
2: 4
3: 46
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987811419 Original CRISPR AAGAACAAGGGGAAGGATGC AGG Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900308656 1:2023116-2023138 AGAAACACTGGGAAGGATGCTGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900628278 1:3619625-3619647 AAGATGAAGGGGAAGCATGGCGG - Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901759678 1:11462605-11462627 AATGAGCAGGGGAAGGATGCTGG - Intergenic
902030057 1:13415794-13415816 AAGAACAAAGGGAGGGAGGGAGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902962716 1:19976248-19976270 AGCAACAAGGGGAAGTCTGCTGG + Intronic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903808277 1:26020806-26020828 AAGATCAAGGGGAGGCACGCAGG + Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904246295 1:29190463-29190485 AAGAAAAAGGTACAGGATGCAGG + Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
905105958 1:35563738-35563760 AAGAAAGGGGGGAAGGATGGAGG - Intronic
905226285 1:36481268-36481290 AGCACCCAGGGGAAGGATGCCGG - Intronic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906653186 1:47527991-47528013 AGAAACAAGGGGAAGGAGGGAGG + Intergenic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
907817102 1:57929724-57929746 AGGTCCAAGGGGAAGCATGCAGG + Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
911050002 1:93662927-93662949 AAGAACTACAGGAAGGATGCAGG - Intronic
911231826 1:95369997-95370019 AAGAACAAGGCAAAGAATGGTGG - Intergenic
911728259 1:101265179-101265201 AAGAAGATGGGGAGAGATGCAGG - Intergenic
911868257 1:103056182-103056204 AGGAACTAGGGGAAAAATGCAGG + Intronic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913073331 1:115320374-115320396 AAGCACAAGAGTAGGGATGCTGG - Intronic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
915157606 1:153891269-153891291 AAGAAAAAAGGGAAGGCAGCCGG + Intronic
915334090 1:155130428-155130450 ATGAACTAGGGGAGGGGTGCTGG + Intronic
915737337 1:158093468-158093490 AAGAGCCAGGGGAAGGCTGTGGG - Intronic
916267842 1:162909078-162909100 AAGAATAAGGGGACAGATACTGG - Intergenic
916323856 1:163535200-163535222 AAGATCACTGGGAAGGATGCAGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
917577180 1:176335846-176335868 AAGAACAAAAGGAAGAATGAAGG - Intergenic
917916289 1:179705659-179705681 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
918146361 1:181759430-181759452 GAGTGCAAGGGGAAGGATTCTGG + Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918373697 1:183887187-183887209 AAGAAGGAGGGGAAGGAGGGAGG - Intronic
919094208 1:193010368-193010390 AAGAAAGAAGGGAAGGATGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919731315 1:200915328-200915350 AGGAACCTGGGGGAGGATGCAGG + Intronic
919779811 1:201214503-201214525 AAGAACAAGGGGTATGCTGAGGG - Intronic
920420234 1:205828118-205828140 AAGAGTAAGGGGAGAGATGCAGG + Exonic
920904557 1:210149887-210149909 AAGACCAAGGGGGAGAAAGCAGG + Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921440536 1:215181441-215181463 AAGAACCAGGGCAAGAATTCTGG - Intronic
921672972 1:217946731-217946753 AAGAACTCGGGGGAGGAGGCAGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922118039 1:222633709-222633731 AAGGGCTAGGGGAAGGATGTGGG + Intronic
922176093 1:223199098-223199120 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923432483 1:233936652-233936674 AAGAAGAAGGGGAAGAAAGGAGG - Intronic
923501194 1:234566191-234566213 CAGTACAAAGGGAAGGATTCTGG - Intergenic
923799583 1:237194477-237194499 GAGAACAAGGGGCAGAATCCAGG + Intronic
923857060 1:237856590-237856612 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
924016548 1:239731556-239731578 AAGAACAAGAGAAAGGAAGAGGG + Intronic
924040272 1:239977870-239977892 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924637361 1:245800790-245800812 AGGAACTTGGGGAAGGATTCGGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1063628351 10:7712056-7712078 AAGAAAAAGGGGGAAGGTGCTGG - Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064653602 10:17534884-17534906 AAGAACAAAGGGAAGATTGGAGG + Intergenic
1067365081 10:45619524-45619546 AAGAACAAGTGGAAGGAGTGAGG + Intronic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1068975294 10:63002531-63002553 AAGAAGAGGGGTAGGGATGCCGG - Intergenic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069176822 10:65300651-65300673 AAGAACAAGAGGAATGATGGTGG + Intergenic
1069200793 10:65613276-65613298 CTGAACAAGGGGAAGTTTGCAGG - Intergenic
1069752974 10:70756566-70756588 AAGAACAAAGGAAAGGTTGGGGG + Intronic
1069905757 10:71731137-71731159 AAAATGAAGGGGAAGCATGCCGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070697878 10:78576379-78576401 AAGTTCAAGGGGAAGGAAGAAGG + Intergenic
1070705520 10:78635098-78635120 AAAAACAAGGGCATGGCTGCTGG - Intergenic
1070935133 10:80288149-80288171 AAGAACAAGAGCAAGGAAGATGG + Intronic
1071410690 10:85390667-85390689 AAAAAAAAAGGTAAGGATGCCGG + Intergenic
1071472442 10:85993210-85993232 GAGGACAAGGGGAGGGATGTGGG + Intronic
1071854369 10:89608366-89608388 AAGAAGGAGGGGAGGGATGGTGG + Intronic
1071862218 10:89685975-89685997 TAGCACAAGTGGAAGGATGAAGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072948692 10:99834001-99834023 AGGACCAAGGGGAAGGGAGCTGG - Intronic
1074290954 10:112137691-112137713 AGGGACAAGGGGAGGGATGCTGG - Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1076453257 10:130571608-130571630 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1077302488 11:1853738-1853760 AAGGACAAGGCCAAGGATTCTGG + Intronic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1077792841 11:5460669-5460691 AAGAACCAGGGAAAGAATTCTGG - Intronic
1077797397 11:5507090-5507112 AAGAACACTGGGAAAGTTGCAGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1079324907 11:19483451-19483473 AAGCACAAGGGTAGTGATGCTGG + Intronic
1080474247 11:32574978-32575000 AAGAACAAGAGAAAGGAAGAAGG + Intergenic
1081177894 11:39951390-39951412 AAGACAAAGGGGAAGCAAGCAGG - Intergenic
1081471917 11:43381996-43382018 AAACTCAAGGGGAAAGATGCAGG + Intronic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081982589 11:47277640-47277662 AAGCACAAGGGTACTGATGCTGG - Intronic
1082091059 11:48090254-48090276 CAGAAAGAAGGGAAGGATGCAGG - Intronic
1084025009 11:66442582-66442604 AAGATCAAGGGGCAGCAGGCGGG - Intronic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085146582 11:74204603-74204625 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1085559173 11:77454481-77454503 GAGAAGAAGGGAATGGATGCTGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1087968106 11:104444023-104444045 AACAACCAGGAAAAGGATGCAGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088319492 11:108540817-108540839 AAGAAAAAGGGGAGGGGTGGAGG - Intronic
1088506324 11:110531281-110531303 AAGCACAAAGGGATGGCTGCTGG - Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1089709039 11:120301931-120301953 ACCAAGAAGGGAAAGGATGCAGG - Intronic
1089742136 11:120591825-120591847 AAGAAGAGGAGGAGGGATGCAGG - Intronic
1090172965 11:124621208-124621230 AAGAACAAAGGGGGGCATGCTGG - Intergenic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1091300995 11:134508147-134508169 AAGGACAAGTGGAAGAATGAAGG + Intergenic
1091597622 12:1889239-1889261 AAGAAGAAGGGGAATGATATGGG + Intronic
1091647119 12:2282288-2282310 AAGAAGAAGAGGGAGGAAGCAGG - Intronic
1092162643 12:6324385-6324407 AAGAAGAACTGGAAGGAAGCAGG - Intronic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1093588965 12:20876533-20876555 AAGAGCAATGGGATGGATGCTGG + Intronic
1093602419 12:21044647-21044669 AAGAGCAATGGGATGGATGATGG + Intronic
1094158718 12:27367135-27367157 AAGCACAAGAGTAATGATGCTGG - Intronic
1094443829 12:30508091-30508113 AAGAACAAAGAGGAGGATGGAGG - Intergenic
1095313415 12:40728392-40728414 AGGAACAAGGGGAAGGGTAGAGG + Intronic
1095694356 12:45127965-45127987 AAGAACAAGGGGGAGAAAGAGGG - Intergenic
1095747907 12:45680428-45680450 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1096256470 12:50064987-50065009 CAGAACAAGGGGGAACATGCTGG + Intronic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096572924 12:52534009-52534031 AAGAGAAAGGGGCAGGCTGCAGG + Intergenic
1097623480 12:61971050-61971072 AAGAAGAAGTGGAAAGAAGCTGG + Intronic
1097738633 12:63212130-63212152 AAGGAGAAGGGGATGGAAGCAGG - Intergenic
1097998557 12:65916797-65916819 AAGAATTGAGGGAAGGATGCAGG + Intronic
1098001128 12:65944514-65944536 AAGTGTAAGGGGAAGGATCCAGG + Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1100214050 12:92429202-92429224 ATGAGCAAGGAGATGGATGCTGG - Exonic
1100273240 12:93046390-93046412 GAGAACAAGGGGAGGGATAATGG - Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1101135868 12:101742523-101742545 AGGAAGGAGGGGAGGGATGCTGG - Intronic
1102247557 12:111364938-111364960 AAGAATTTGGGGAAAGATGCAGG + Intronic
1102603383 12:114050368-114050390 TAGAACAATGGAAAGGATGTGGG - Intergenic
1102812188 12:115833843-115833865 AAGAGAAAAGGGAAGGATTCAGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1103200131 12:119081492-119081514 GAGAACAAGGGGAAAGGAGCAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1104437449 12:128767143-128767165 AAGAAAAAGGGAAAAGATGAAGG + Intergenic
1104692075 12:130833952-130833974 AAGCACTGGGGGAAGGGTGCAGG + Intronic
1105459651 13:20571661-20571683 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1105666276 13:22560314-22560336 AAGAACCTGGGGAAGGATTAGGG + Intergenic
1105774939 13:23650129-23650151 AAGAGCTAGGGGAAGAATGGAGG - Intronic
1106707831 13:32300586-32300608 ATGAATAAGGGGCAGGAAGCAGG - Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109429640 13:62214356-62214378 AAGAACAAAGGGAAGGTTAGAGG + Intergenic
1109952786 13:69522570-69522592 AAGAACAATAAGAAGGATGGAGG - Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110552816 13:76827616-76827638 AAAAAAAAGGGAAAGGATGCTGG - Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1110799800 13:79681790-79681812 AAGCACAAGAGTAATGATGCTGG - Intergenic
1111213595 13:85113410-85113432 AAGAAGTAGAGAAAGGATGCAGG - Intergenic
1111240419 13:85466237-85466259 AAGACAAAGGGGAAGCAAGCAGG + Intergenic
1112587007 13:100727751-100727773 AAAAAAAAGGGTCAGGATGCTGG - Intergenic
1112947014 13:104941479-104941501 AAGAAAAGAGGGAAGGATGGAGG + Intergenic
1113277940 13:108754285-108754307 AAGAACAAGCTGTAGCATGCAGG + Intronic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1116855281 14:49946536-49946558 ATGAAACAGGGGAAGGACGCTGG - Intergenic
1117453267 14:55872831-55872853 GAGAACAAGGTGGTGGATGCTGG - Intergenic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1120192936 14:81455536-81455558 GACAAAAAGGGGAAGGATTCAGG + Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1121026299 14:90618831-90618853 AAGAACACCAGGAAGGAAGCTGG - Intronic
1121410580 14:93745991-93746013 AGGGAGAAGGGGAAGGATGGGGG - Intronic
1122071231 14:99206659-99206681 AAGTGCAAGGGCAATGATGCTGG + Intronic
1122213814 14:100190478-100190500 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122602021 14:102926316-102926338 AAGGGCAAGGCGGAGGATGCTGG - Intronic
1122674771 14:103402772-103402794 AAGAACAAAGTAAAGGATGGAGG + Intronic
1123980008 15:25593233-25593255 AAGTTCAAGGGGAATGGTGCTGG + Intergenic
1126686357 15:51251979-51252001 AAGACAAAGGGTAAGAATGCTGG - Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127485745 15:59416180-59416202 AAGCACAAGTGAAAGGGTGCAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1130914395 15:88293446-88293468 AAGAAAGAGGAGATGGATGCAGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1133095437 16:3442062-3442084 AATAGCAAAGGGAAGGATGTTGG - Intronic
1133633837 16:7647478-7647500 AGGAACAATGGAAAGGACGCAGG - Intronic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1137266501 16:46873402-46873424 AAGAACAAGGCGTGGGAGGCTGG - Intergenic
1137962113 16:52892289-52892311 AAGAATAAGGGGAACGATTCTGG + Intergenic
1138566628 16:57838164-57838186 AAGAACAAAGAGAAAAATGCAGG + Intronic
1138622707 16:58224608-58224630 ATGGCCACGGGGAAGGATGCTGG - Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139187011 16:64818658-64818680 ATGAACGAAGGGGAGGATGCTGG - Intergenic
1139730280 16:68938244-68938266 AAGAACAATGAGAAGGTTGGAGG + Intronic
1140523286 16:75600771-75600793 AAGAACAAAGGGAAGGTTAGAGG - Intronic
1140621623 16:76740933-76740955 AAGAACAAGTGTAAGAATTCTGG + Intergenic
1140791982 16:78400636-78400658 AGGAAAAGGGGGAAGGAAGCAGG + Intronic
1142019371 16:87771421-87771443 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
1143337636 17:6185241-6185263 AAATCCAAGGGGAAGGATGAAGG - Intergenic
1143408010 17:6690861-6690883 AAGATCAAGGTGATGGCTGCCGG + Exonic
1144022099 17:11246566-11246588 AAGGGCTAGGGGAAGGATGCTGG + Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1147589116 17:41669929-41669951 ATGAACAATGGGAAGGTTGTGGG + Intergenic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148454760 17:47805044-47805066 AAGGACTTGGGGGAGGATGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148739943 17:49887185-49887207 AAGCACATGGGGGAGGAAGCAGG - Intergenic
1149209519 17:54287649-54287671 AAGAAGAAAGGCAAGGGTGCAGG + Intergenic
1149213301 17:54327898-54327920 AAGAAGAAAGGCAAGGGTGCAGG - Intergenic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1149778570 17:59378105-59378127 ATGTTCAAGGGAAAGGATGCCGG - Intronic
1149825771 17:59826569-59826591 ATGAAGAAAGGGAAGGATGTGGG + Intronic
1150931584 17:69590557-69590579 AAGAACAAGAGGCAGGAGGGTGG - Intergenic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1151316074 17:73323488-73323510 AGGAACAAGGGGAAGGAGCGTGG + Intergenic
1151545136 17:74788258-74788280 AAGAAAAAAGGGATGGATTCCGG + Intronic
1152813575 17:82393866-82393888 AAGGACAGGGGGAAGGATGGAGG + Intronic
1153043031 18:832084-832106 AAGCACAAGGGTAGGGATGCTGG - Intergenic
1153421138 18:4906661-4906683 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
1153554115 18:6293001-6293023 AAGAACAAAGAGAAGGTTGGAGG - Intronic
1154021609 18:10668373-10668395 AAGAATAAGGGGCAGGCTGGTGG + Intronic
1155908526 18:31481962-31481984 GAGAAAAAGAGGGAGGATGCGGG - Intergenic
1156782750 18:40870751-40870773 AAGCACAAGGGGAAAGGTGAAGG - Intergenic
1157276983 18:46317999-46318021 AAAACCAAGGAGGAGGATGCAGG - Intergenic
1157852636 18:51070863-51070885 AAGTGCAAGGGTAATGATGCTGG + Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159327420 18:66941022-66941044 TAGATCAAGGGGAAGGTTGCAGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1160563930 18:79775361-79775383 AAGCACAAGAGCAATGATGCTGG - Intergenic
1160676771 19:395250-395272 AAGATGATGGGGAAGGATGATGG + Intergenic
1160676796 19:395350-395372 AAGATGATGGGGAAGGATGATGG + Intergenic
1160676821 19:395450-395472 AAGATGATGGGGAAGGATGATGG + Intergenic
1160676851 19:395573-395595 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676913 19:395875-395897 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676919 19:395899-395921 AAGGACAATGGGAAGGATGATGG + Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1162203008 19:9034867-9034889 AAGAACGAGGGGAAGAAAGGAGG + Intergenic
1162826082 19:13253097-13253119 TAGAACTAGGGGAAAGAAGCAGG + Exonic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163771257 19:19192583-19192605 AAGAAGTAGGGGAAGTACGCGGG - Exonic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164944528 19:32282331-32282353 AAGAAAAAGCTGAAAGATGCTGG - Intergenic
1165684552 19:37807949-37807971 AAACTCAAGGCGAAGGATGCAGG + Intronic
1165961784 19:39540773-39540795 AAGAAGAAGAGGAAGGGTTCTGG - Intergenic
1167221728 19:48203819-48203841 AGGAACAAGGTTAAGGAAGCTGG - Intronic
1167511850 19:49899286-49899308 AAGGACAAGGGGATTGGTGCAGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
925256739 2:2496283-2496305 AAGAACTAGAGGGAGGAGGCGGG + Intergenic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926554401 2:14341010-14341032 AAGTACAAGGGTAGTGATGCTGG + Intergenic
926875786 2:17477214-17477236 AAGAACAAGAGGAATAAAGCAGG + Intergenic
927415695 2:22878287-22878309 AAGAACAATTGGCAGGCTGCAGG + Intergenic
927928980 2:27032183-27032205 AAGAACAAGGAAGAGGATGGGGG - Intergenic
928108036 2:28485268-28485290 AAGAACGAGGGGCAGAATTCTGG + Intronic
928945585 2:36769078-36769100 AAGAGAAACAGGAAGGATGCTGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
930681906 2:54265549-54265571 AGGAGAAAGGGGAAGAATGCAGG + Intronic
931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG + Intergenic
932238041 2:70136759-70136781 AAAAACAAGGGGTGGGAGGCAGG - Intergenic
932869108 2:75378957-75378979 AATAACAAAGGGAAGCATGTAGG + Intergenic
933082508 2:78009773-78009795 AAGAACAAGAGTAGTGATGCTGG + Intergenic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933327381 2:80855370-80855392 AAGCACATGGGGCAGGATCCAGG - Intergenic
935154104 2:100466841-100466863 AAGCACAAGAGTAATGATGCTGG + Intergenic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
935747129 2:106198357-106198379 AATAGCAAAGGCAAGGATGCTGG + Intergenic
935874822 2:107494869-107494891 AGGAAAAAGGGGAAGGATGGAGG + Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937253366 2:120538177-120538199 AAGACCAAGGGGAAGTTTGTTGG - Intergenic
937854883 2:126665138-126665160 AAGATCAAGAGGAAGGATGTAGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938615061 2:132989076-132989098 AGGAACAAGAGGAAGCATGGCGG + Intronic
938671963 2:133595359-133595381 AAGAAGAAGGGGGAGGATGAGGG - Intergenic
938789414 2:134663665-134663687 AGGAAGATGAGGAAGGATGCAGG - Intronic
940920078 2:159296364-159296386 AAGAACAAGCTGCAGGAAGCTGG - Intergenic
941002973 2:160220901-160220923 GAGAACAAAGGCAAGGAAGCTGG - Intronic
941573765 2:167204110-167204132 AAGAACCAGGCGAAGTGTGCTGG - Intronic
941884829 2:170517127-170517149 AAGAACAGGGAGAAGGATTTGGG - Intronic
942018971 2:171848101-171848123 AAGAACCAGGGGAGGGATGAGGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942615032 2:177782842-177782864 AAGAAGGAAGGGAAGGATGGAGG - Intronic
943304602 2:186244396-186244418 AGGAAGCAGGGGAAGGATGATGG + Intergenic
943445020 2:187973987-187974009 AGGAACAAGAGGAAAGATGCAGG - Intergenic
943624621 2:190184698-190184720 AGGAACAGGGGAAAGGGTGCTGG + Intronic
943690193 2:190861713-190861735 AAGAAGTAGGAAAAGGATGCTGG + Intergenic
943793682 2:191965238-191965260 AAGAAGCAGGGGAAGGAAGTGGG - Intronic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
945984808 2:216344978-216345000 AAGCAGAAGGGGAAAGATGTTGG + Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946378282 2:219327466-219327488 AAGGGCAATGGGAAGGGTGCTGG + Exonic
947008166 2:225536325-225536347 AATGACAAGGGGCAGGAAGCAGG - Intronic
947094867 2:226554779-226554801 AAGAGCAAAGGGAAGGCTTCAGG + Intergenic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
948369086 2:237475808-237475830 TAGACCCAGGGGAAGGATGCAGG + Intergenic
948417564 2:237824649-237824671 TAGAGCAAGAGGAAGAATGCGGG - Intronic
948564376 2:238874437-238874459 AAGAAAAATGTTAAGGATGCAGG + Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
949010041 2:241673102-241673124 AAGGACATGGGGAAGGCTCCTGG - Exonic
1169353210 20:4886873-4886895 CAGCTCAAAGGGAAGGATGCTGG - Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169646722 20:7819338-7819360 AAGAACAATGGGAAGGATCCAGG + Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170450522 20:16478712-16478734 AAGCACAAGAGTAATGATGCAGG + Intronic
1171158299 20:22897201-22897223 GAGAACATGTGGAAGGATGTGGG - Intergenic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1172019863 20:31906470-31906492 AAGACCAATGGGGAGGATGCAGG - Intronic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1173308136 20:41871423-41871445 ACGATCAAAGGGAATGATGCAGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173359632 20:42330795-42330817 AAGAACAAGCAGAATGCTGCAGG + Intronic
1173912609 20:46681436-46681458 AAGAAAGAGGGGAAGGAGGGAGG + Intronic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1175516283 20:59572227-59572249 AGGAACAAGAGCAGGGATGCGGG + Intergenic
1175686134 20:61030075-61030097 AAGCACGTGGGGAAGGATGGGGG + Intergenic
1176023160 20:62972891-62972913 AAGGACAAGGGGCAGAATCCTGG + Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177279144 21:18956548-18956570 AAGAACAAGTGGAAGTATTTTGG - Intergenic
1177635526 21:23782786-23782808 AAGAACAAGAGTAGCGATGCTGG - Intergenic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178357898 21:31923710-31923732 AAGAACAGAAGGAAGGATGGAGG - Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179395509 21:41036476-41036498 AAGCCCAAGGGGAAGGAGACAGG + Intergenic
1179594291 21:42431560-42431582 AACAGCAAGGGGATGGATGAGGG + Intronic
1179612258 21:42559957-42559979 AAGAGTGAGGGGGAGGATGCAGG + Intronic
1180229471 21:46418378-46418400 CAGAACCAGGCAAAGGATGCAGG - Intronic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182235572 22:28873501-28873523 AATAAGAAGAGGAAGGATACTGG - Intergenic
1182862157 22:33569563-33569585 AAGAACAAGTGGTAAGAAGCAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1184002113 22:41682593-41682615 AAGAATTAGGTGAAGGATGGAGG + Intronic
1184186057 22:42866258-42866280 AAGAACCAGGGTCAGGATGGAGG - Intronic
1184318361 22:43718129-43718151 AAGAAAAAGTGGTAGGATTCAGG + Intronic
949915195 3:8956224-8956246 AAGCACAAGAGTAATGATGCTGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952280974 3:31923059-31923081 AAGAACAAGGGGCAAGGTCCAGG + Intronic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
953705539 3:45227145-45227167 AAGAACGATGGGAATGATGAAGG - Intergenic
954036974 3:47856093-47856115 GAGACCAAGGGGAAGGGTGCGGG + Intronic
954485828 3:50850571-50850593 AAGAACCAGGGCAAGAATTCTGG - Intronic
954941771 3:54379750-54379772 AAGGAGAACAGGAAGGATGCAGG - Intronic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955410451 3:58652351-58652373 ATGGACAGGTGGAAGGATGCTGG - Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956851627 3:73233260-73233282 AAGGACAAGGGATAGGATGGGGG + Intergenic
957239420 3:77639124-77639146 AAGAACTAGGGGAAAGGGGCCGG - Intronic
957547672 3:81661658-81661680 AAGAACAATTGGTAGGATGGTGG - Intronic
958982012 3:100732422-100732444 AAGTACAAGGGAAATAATGCAGG - Intronic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
959951298 3:112183756-112183778 AGGAACCTGGGGGAGGATGCAGG - Intronic
960292993 3:115909160-115909182 AAGATCAAAGCTAAGGATGCAGG - Intronic
961499134 3:127318687-127318709 AAGAGCAAGTGGAAGTATCCAGG + Intergenic
962236976 3:133715041-133715063 AAGACCACGGGGAAAGGTGCGGG - Intergenic
963931462 3:151008340-151008362 AAGAACAAAGTCAAGGAGGCAGG - Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964624740 3:158748317-158748339 AGGAATAAGGGGAAGGGTGAAGG - Intronic
964974444 3:162602010-162602032 AAGAACCAGTGCAAGAATGCTGG + Intergenic
965857048 3:173102104-173102126 AGGAATAAGGGGAAGGGTTCAGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
965938051 3:174139623-174139645 AATAAAAAGGGGAAAAATGCTGG + Intronic
967500642 3:190193536-190193558 AAGCACAAGGGTAGTGATGCTGG + Intergenic
968129861 3:196186781-196186803 AAGGACACGGGGACGGCTGCAGG - Intergenic
968576076 4:1366763-1366785 AAGAACCAAGGGTAGGATGGTGG - Intronic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
969288735 4:6225019-6225041 GAGACAAAGGGGAAGGCTGCAGG - Intergenic
969495286 4:7522943-7522965 AGGGAGAAGGGGAAGGATGGGGG - Intronic
970261149 4:14226548-14226570 AAGATCAAGGGAAATCATGCAGG + Intergenic
970383719 4:15535346-15535368 AAGAAGGAGGGGAGGGATGGAGG - Intronic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
973240430 4:47950613-47950635 AAAAACAATGGGAAGGCTGGAGG + Intronic
974803602 4:66851621-66851643 AAGTAAAAGGCCAAGGATGCAGG + Intergenic
975119136 4:70709826-70709848 AAAGACAAGGGCAAGGATGTGGG - Intronic
975901581 4:79159704-79159726 AAGAACAGAGGGAAGGATAATGG - Intergenic
976048995 4:80988378-80988400 AAGAAAAAATGGAAGGATGTCGG - Intergenic
976134551 4:81921737-81921759 AGAAAGAAGGGGATGGATGCAGG - Intronic
978311392 4:107388037-107388059 AAGAAGAAGGGGAAAGCTGTGGG + Intergenic
978819878 4:112954157-112954179 AAGAAGAAAGGGAAGGATACAGG - Intronic
979133707 4:117082173-117082195 AAGAATAAAGGGAAAGATGCTGG - Intergenic
980332753 4:131430352-131430374 AAGAACAAGGGAAAAAATGATGG - Intergenic
981653800 4:147089251-147089273 AAGATCAAGGGAAAGTCTGCAGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
983307930 4:166017671-166017693 AAGAACAAGAGGAAGGGAGGGGG - Intronic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983885940 4:172980655-172980677 AACAACAAGAGGAAGGAAGAGGG - Intronic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985851095 5:2389592-2389614 GAGAACAAGGCCAAGGATGAGGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986214485 5:5706690-5706712 AAGAAGAAGGGAATGGATGGAGG - Intergenic
986426067 5:7632998-7633020 AAGATCCAGGGGGAGGATGAAGG + Intronic
986522367 5:8633365-8633387 AGGAAGAAGGGGAAGGAAGTGGG - Intergenic
986701406 5:10412919-10412941 AGGAACAAGGGGAGAGATGAGGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988088382 5:26502382-26502404 AATAACAAAGGGAAGGTTGGTGG + Intergenic
988437288 5:31191217-31191239 TAGAGCTAGGGGAAGAATGCTGG + Intergenic
990327611 5:54693962-54693984 AAGAGCAAGGGGAAGGGCCCTGG - Intergenic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
990461812 5:56037731-56037753 GAAAACAAGGGGAAGGAAGGTGG - Intergenic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991450157 5:66743072-66743094 AAGACCAAAAGGAAGGAAGCTGG - Intronic
991515524 5:67430815-67430837 AAGAACAAAGGAAAGGTTGAGGG - Intergenic
992155284 5:73949281-73949303 AACAACTAGGTGAAGGCTGCAGG + Intergenic
992836346 5:80645270-80645292 AAGAACAAAGGGAAGGTTAGAGG - Intronic
992881500 5:81114728-81114750 AAGAACAAGTGCAAGGACCCTGG - Intronic
997654866 5:135547228-135547250 AAGAAAAAGGGGTAGTCTGCGGG - Intergenic
998014830 5:138723850-138723872 AAAAACAAGTGGAAGGAAGATGG + Intronic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998174775 5:139895003-139895025 AAGAAGAAGGGGAAGGGAGGAGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
1000210550 5:159103475-159103497 AATCACATGGGGAAGGGTGCAGG + Intergenic
1000641422 5:163707068-163707090 ATTAACAAGTGGAAGGCTGCAGG - Intergenic
1001265485 5:170271179-170271201 AGAAGAAAGGGGAAGGATGCTGG + Intronic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001791057 5:174458492-174458514 AAGGAGATGGGGAAGGATGTGGG - Intergenic
1001946900 5:175786750-175786772 AAGAACAGAGGGAAGGAGGGAGG - Intergenic
1002370740 5:178752053-178752075 AAGAAGAAAAGGAAGGAAGCAGG - Intergenic
1002406007 5:179032064-179032086 AAGAAGAGGAGGAAGGAAGCAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003977445 6:11357300-11357322 AAAAACAAGCCAAAGGATGCGGG - Intronic
1004811554 6:19269306-19269328 AGGAATAAGGGGAAGGATGTGGG - Intergenic
1004885352 6:20045971-20045993 AAGAACAAGGGGGATGAAACTGG + Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1007059382 6:38923695-38923717 AAGAGCAAGGGACAGGATGGGGG + Intronic
1007362861 6:41371378-41371400 AGGACCAGAGGGAAGGATGCAGG - Intergenic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1009470153 6:64022847-64022869 AAGAACAAAGAGAAGGTTGGCGG - Intronic
1009848927 6:69171408-69171430 AAGAACAAGGGTATGGAAGTTGG - Intronic
1009886728 6:69632117-69632139 TAGAAAAAGAGGAAAGATGCAGG + Intergenic
1010813312 6:80324937-80324959 AGGAAGATGGGAAAGGATGCTGG + Intronic
1011375804 6:86685535-86685557 AAGCACAAGGGTAATGATGCTGG + Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012242902 6:96894366-96894388 AAGCACAAGGGTAGTGATGCTGG + Intronic
1012345020 6:98174482-98174504 ATGTAGCAGGGGAAGGATGCAGG + Intergenic
1013351785 6:109312458-109312480 AATAACAAGGTGGAGGATGGTGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015224977 6:130847151-130847173 GAAAACAATGGGAAGGATGTCGG - Intronic
1015391769 6:132690401-132690423 ATGAACAAGGGTGTGGATGCAGG - Intronic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016814485 6:148290976-148290998 AAGATAAAGTGGAAGAATGCAGG - Intronic
1016876318 6:148869116-148869138 AGGCACAAGGGAAAGAATGCAGG - Intronic
1017634764 6:156432726-156432748 AGGAAGAAAGGGAAGGGTGCAGG + Intergenic
1018081839 6:160265885-160265907 AAGAACAAGTGGATGGATTTAGG - Intronic
1018321030 6:162608756-162608778 AAGAACATAGGGAGGCATGCTGG + Intronic
1018890066 6:167976858-167976880 AAGACCCAGGGGCAGGAGGCCGG - Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1018998233 6:168726184-168726206 AAGAAAACGAGGAAGGATGAAGG + Intergenic
1019825059 7:3277566-3277588 AGAAAGAAGAGGAAGGATGCGGG - Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020541568 7:9465306-9465328 AAGAACAAGTGCAAGGATTCTGG - Intergenic
1020731134 7:11882430-11882452 AAGGAGAAGGGGAGGGATGGAGG - Intergenic
1020903095 7:14030297-14030319 AAGAACAAGGTGGAGGGAGCTGG + Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1023895811 7:44431966-44431988 AAAAACAAATGGAAGGAGGCTGG - Intronic
1024331586 7:48160542-48160564 AAGTGCAGGGGGAAGGATGGAGG + Intergenic
1026518756 7:71096522-71096544 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026917461 7:74129531-74129553 AAGGAGAAGGGGAAGGAAGGAGG + Intergenic
1027589284 7:80097190-80097212 AATAACAAGGAGCAGGATGGTGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029488278 7:100856495-100856517 AAGAAGAAGGGGCAGGGCGCCGG - Intronic
1030329927 7:108260419-108260441 AGGTACAAGGGGAGAGATGCTGG + Intronic
1031526340 7:122825566-122825588 AAGAACAAGGTAAAGGAAACAGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032419897 7:131770105-131770127 AAAGACAGGGGAAAGGATGCTGG - Intergenic
1032471532 7:132182531-132182553 GAGGACCAGGGGAAGGATGGAGG - Intronic
1032654014 7:133907853-133907875 AAGAAGGAGGGGAAGGAGGGAGG + Intronic
1033466822 7:141599105-141599127 AAGAAAAAAAGAAAGGATGCTGG - Intronic
1034395773 7:150824083-150824105 AAGAACAAAGAGAAGGCTGGAGG - Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035154433 7:156900675-156900697 GGGAACAAGGGGAAGAATGATGG - Intergenic
1035391221 7:158506311-158506333 AAGAACATGGCCAAGGCTGCGGG + Intronic
1035724122 8:1813955-1813977 AAGGACAGGGGGCAGGATGGAGG + Intergenic
1035735878 8:1887364-1887386 AAGACCAGTGGGCAGGATGCGGG + Intronic
1036561886 8:9905401-9905423 ATGAATAAGGGGGGGGATGCTGG + Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037146885 8:15582881-15582903 AAGAACAAAGAGAAGGTTGTAGG - Intronic
1037800776 8:22034082-22034104 AATAGCATGGGAAAGGATGCAGG - Intronic
1038188932 8:25301068-25301090 AAGTACAAGAGGAGTGATGCTGG + Intronic
1038955334 8:32462157-32462179 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1040519296 8:48161089-48161111 AAAAACAAGTGTAAAGATGCAGG + Intergenic
1040591151 8:48793301-48793323 AAGAAGAAAAGGAAGGATACAGG - Intergenic
1040691654 8:49945851-49945873 AAGAACAAGGGGATATTTGCTGG + Intronic
1041006045 8:53497677-53497699 AAGAACAAGGAGCAGGCTCCTGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041426622 8:57728034-57728056 AAGAGCAAGGGTGAGGATGCTGG + Intergenic
1041964570 8:63660170-63660192 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1042015132 8:64300734-64300756 AAGAATAAGGGGGTGGATGGAGG - Intergenic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042146041 8:65731284-65731306 GACATCAAAGGGAAGGATGCGGG + Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042747559 8:72123415-72123437 AAGAACACAGGGCAGGAAGCTGG + Intergenic
1042943348 8:74129895-74129917 AAGAACATGAGAAAGCATGCTGG + Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG + Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1045930511 8:107620450-107620472 AGGAGCAAGGGCAAGGATGCGGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046254868 8:111682615-111682637 AAGCACAAGCGTAATGATGCTGG - Intergenic
1046368935 8:113274853-113274875 AAGAAAAAAAGGAAGGAAGCAGG + Intronic
1046491088 8:114953492-114953514 AAGTATTAGGGGGAGGATGCAGG - Intergenic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1047326057 8:123836899-123836921 AATAACAAAGAGAAGGAAGCGGG - Intergenic
1047591797 8:126335111-126335133 AAGAACAAGGCGTGGGATGTGGG - Intergenic
1047648642 8:126896052-126896074 AAGAATGAGGGGAGAGATGCTGG - Intergenic
1048042618 8:130745901-130745923 AAGAGGAAGAGGAAGGATTCAGG + Intergenic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1048922274 8:139242046-139242068 TAGAAACAAGGGAAGGATGCTGG + Intergenic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1050173979 9:2851134-2851156 AGGAACCAGGGGAAAGAAGCAGG - Intergenic
1050353719 9:4763539-4763561 AGGAAAAAGGGGGAGGAGGCAGG + Intergenic
1050694050 9:8259777-8259799 TAGAAAAATGGGAAAGATGCTGG - Intergenic
1051010700 9:12409966-12409988 AAGAAAAATGGGAAGGAATCCGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051527603 9:18064204-18064226 AAGAGCAAGGAGAAGGGTGTGGG + Intergenic
1051712305 9:19944450-19944472 AAAAAAAAAAGGAAGGATGCAGG + Intergenic
1053144865 9:35705506-35705528 AGGAACAAGGGGCAGGGGGCAGG + Intronic
1053350722 9:37411768-37411790 AGGAGCAAGGGGATGGAGGCAGG - Intergenic
1053474754 9:38374472-38374494 AAGAACAATGGGGAGGATAAGGG - Intergenic
1055084247 9:72298211-72298233 AAGAACAAGAGTAGTGATGCTGG - Intergenic
1055721880 9:79183704-79183726 AAGAACAAGAGCAAAGCTGCAGG + Intergenic
1055959480 9:81806718-81806740 TAGAACAATGGGAAAGATGTGGG + Intergenic
1056085447 9:83144506-83144528 AGGAACAAGGGGAAGATTTCAGG + Intergenic
1056400033 9:86217925-86217947 AAGAACAAAGAGAAGGTTGCAGG - Intergenic
1056672821 9:88645931-88645953 AAGAAAAGGGGGAAGGCTACAGG + Intergenic
1057108604 9:92445313-92445335 AGGCTCAAGGGGAAGGAAGCTGG - Intronic
1058049187 9:100389459-100389481 AAGAACAAAGGGAAGGTTGGAGG - Intergenic
1059596971 9:115731270-115731292 AATAACAAGAAGAAAGATGCAGG - Intergenic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1061360780 9:130141014-130141036 GGGAAAAAGGGGAAGGATGTGGG - Intergenic
1061372969 9:130208175-130208197 AAGAAAGATGGGATGGATGCAGG + Intronic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1185593065 X:1291424-1291446 AAGAAAAAGAGGAAGGAAGGAGG - Intronic
1185665206 X:1760098-1760120 AAGGAGAAGGGGAAGGAAGGAGG - Intergenic
1185724893 X:2411757-2411779 AAAAACAAAGGGAAACATGCCGG + Intronic
1186215893 X:7300860-7300882 ATTAAGATGGGGAAGGATGCAGG + Intronic
1186516528 X:10170468-10170490 AAACACAATGGCAAGGATGCAGG + Intronic
1187652535 X:21424749-21424771 AGGAACAAGGGGAAAAATGAAGG - Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189003043 X:36965085-36965107 AAGAAAGAGGTGTAGGATGCTGG - Intergenic
1189716139 X:43868472-43868494 AGGAACAAGGGGAGAGAAGCAGG + Intronic
1190139382 X:47828978-47829000 TAGAAAAAGGGGAAGGCTTCAGG + Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1192347951 X:70327463-70327485 TGAAACAAGGGGAAGGATGAAGG + Intronic
1192831653 X:74756529-74756551 AGGAGCAAGGGAAAGGATACAGG + Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193810811 X:86048499-86048521 AAGCAAAAGGGGAAGGATGCTGG + Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1194922483 X:99783315-99783337 GAGATCAAGTGGAAGGCTGCGGG - Intergenic
1196234164 X:113260423-113260445 AAGAACCAGTGCAAGAATGCTGG - Intergenic
1197182700 X:123553313-123553335 ATCAACCAAGGGAAGGATGCCGG - Intergenic
1197336662 X:125217187-125217209 AAGCACAAGAGGAGTGATGCTGG - Intergenic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1198437739 X:136633420-136633442 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1199295994 X:146159312-146159334 AAGCACAAGAGGAATGATGCTGG + Intergenic
1199459900 X:148072835-148072857 AAGATCCAGGGGAGGGATGAAGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic