ID: 987811582

View in Genome Browser
Species Human (GRCh38)
Location 5:22843228-22843250
Sequence GTGTTTTCACAGATAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987811582_987811586 17 Left 987811582 5:22843228-22843250 CCCAATTCTATCTGTGAAAACAC 0: 1
1: 0
2: 0
3: 20
4: 281
Right 987811586 5:22843268-22843290 TCCATGGTGACATGAACTAATGG 0: 1
1: 0
2: 0
3: 3
4: 125
987811582_987811584 1 Left 987811582 5:22843228-22843250 CCCAATTCTATCTGTGAAAACAC 0: 1
1: 0
2: 0
3: 20
4: 281
Right 987811584 5:22843252-22843274 CATAACTTACCAGTTATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987811582 Original CRISPR GTGTTTTCACAGATAGAATT GGG (reversed) Intronic
904634941 1:31872725-31872747 GTGTTATCAAAAATAGAATGTGG + Intergenic
907220338 1:52902869-52902891 GTTTTCTCACAGATAAAATGGGG + Intronic
908285766 1:62598243-62598265 GTGTTTTCATATATAACATTAGG - Intronic
909687139 1:78362460-78362482 GGGTCTTCACAGATATAATCAGG + Intronic
911391689 1:97252838-97252860 GTGTTTTCACAGGTAGTAACTGG + Intronic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
915187361 1:154117870-154117892 GTGTTTTCACAGGTAGAGGGTGG - Exonic
915407551 1:155672721-155672743 GTGTTTTCCCAGAAAGAGCTGGG - Exonic
915773148 1:158451921-158451943 TTGTTTTCATAGAATGAATTAGG - Intergenic
916925569 1:169516837-169516859 GTCATTTCAAAGTTAGAATTCGG - Intronic
917527972 1:175806168-175806190 GTGTTCCCATAGATAGAACTTGG - Intergenic
921750168 1:218783037-218783059 GTGTTTACACAGGTGGAAATAGG + Intergenic
922084657 1:222334598-222334620 GTGTTTTCATAGACAAAAATGGG + Intergenic
922396545 1:225207738-225207760 CTGGTTTCAGAGAGAGAATTGGG - Intronic
1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG + Intronic
1065181761 10:23133484-23133506 GTCTTTTCATGGACAGAATTGGG - Intergenic
1065325278 10:24545326-24545348 GTGTGTTAACAGTTAAAATTTGG - Intronic
1066171908 10:32857421-32857443 TTGTTTTCAGAAATAGTATTAGG - Intronic
1066632390 10:37469832-37469854 CTGTTTTCCCAGACAGAACTGGG - Intergenic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1068920977 10:62483741-62483763 GTTTTTACACAGATAAAATGAGG - Intronic
1069135503 10:64758810-64758832 TTGTTTTCACTGTTAGAATTGGG + Intergenic
1069252789 10:66291812-66291834 ATGTGTTCACACATATAATTTGG - Intronic
1073978544 10:109127667-109127689 GTGTTTTTATAGATATTATTTGG - Intergenic
1077514745 11:2994662-2994684 GAGTCTTCACAGATGCAATTAGG + Intergenic
1078188419 11:9071955-9071977 GTGTTTTCACCCATATAATGAGG - Intronic
1078348799 11:10575370-10575392 CTGTTTTCAAAGAGAGAATAGGG + Exonic
1079374888 11:19883024-19883046 TGGTTATCAAAGATAGAATTTGG - Intronic
1079790723 11:24735644-24735666 GTGTTTTTATAGCTATAATTTGG + Intronic
1080288795 11:30647005-30647027 TTGTTTTCAAAGCTAGATTTGGG - Intergenic
1080626069 11:34031786-34031808 GTGTTTTCTCTGAAAGTATTTGG - Intergenic
1082822059 11:57550755-57550777 GGCTTTTCAGAGATAGAATATGG - Intergenic
1083599998 11:63940788-63940810 GTGTTTTAACAAATAGTTTTGGG + Intronic
1087543904 11:99559385-99559407 GAGTTTTCAAACATAGAGTTAGG - Intronic
1088560274 11:111108037-111108059 GTGTTTTCACAGATCTAATGAGG - Intergenic
1089161827 11:116444324-116444346 GTGTTTTGATAGAAAGAATGTGG - Intergenic
1089630976 11:119783966-119783988 CAGTTTTCACAAATAGAATATGG + Intergenic
1090848879 11:130553555-130553577 GTGTTATTATAGAGAGAATTAGG + Intergenic
1091538791 12:1439970-1439992 GTTTTTTTACAGATAGATTTGGG + Intronic
1091928561 12:4375737-4375759 GTTTTTTCACATATAAAATGAGG + Intronic
1092028610 12:5264348-5264370 TTGTTTTGACTGATAGAATATGG - Intergenic
1092053046 12:5486708-5486730 GTGTTTTCACACTTAGAGATTGG + Intronic
1092671634 12:10868272-10868294 GTGGTTTCAGAGATAGCATATGG - Intronic
1093106042 12:15088340-15088362 GTGTAGTCACAGCTAGAATCAGG + Intergenic
1093226867 12:16495232-16495254 GTGTTTTCTCACTTATAATTGGG + Intronic
1093499579 12:19796946-19796968 GTGGTTTCTCAGAAAGCATTAGG + Intergenic
1095246997 12:39934753-39934775 GTTTTTTCAAAAATAGAAATAGG + Intronic
1096460052 12:51817351-51817373 GAGCTGTCACAGATAGAGTTAGG + Intergenic
1096745735 12:53725775-53725797 GAGTTTTCAGAGCTAGAATATGG + Intronic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1097496662 12:60347516-60347538 GTGTTTTCATTGATATAACTGGG + Intergenic
1098081184 12:66787122-66787144 GTGTGTGCACAGATAGTAATTGG - Intronic
1098476428 12:70909254-70909276 GAGTTCTCACACATACAATTAGG - Intronic
1098607277 12:72406659-72406681 TTGTTTTCACCGCTAGAGTTTGG + Intronic
1099178114 12:79446123-79446145 GTTTTTTCACATATAAAATTAGG - Intronic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1101233107 12:102762200-102762222 GTCTTTTCACAGCTAGGATGGGG - Intergenic
1103083992 12:118047539-118047561 GTATTTTAAAAGAGAGAATTTGG - Intronic
1103426824 12:120843240-120843262 GTGTTTTCTAAGACAGAATGGGG - Intronic
1106063086 13:26314557-26314579 GTGTTTTCATTCTTAGAATTAGG + Intronic
1106904762 13:34393440-34393462 TTGTTTTGACAGCTTGAATTTGG - Intergenic
1107502252 13:40992289-40992311 GTGTGTTCACAGATGCACTTAGG - Intronic
1107531639 13:41288092-41288114 GTCTGTTTACAGATAGAATGGGG + Intergenic
1110647997 13:77911319-77911341 GATATTCCACAGATAGAATTAGG - Intronic
1112721527 13:102251453-102251475 ATGTTTTAAAAGATTGAATTTGG - Intronic
1113012847 13:105790410-105790432 GTGTGTTCACTTATAAAATTGGG - Intergenic
1115370705 14:32610937-32610959 GTGTTTTTAATGATTGAATTTGG + Intronic
1115658085 14:35463181-35463203 GAGTTTTCACATATACAAATAGG + Intergenic
1117064739 14:52001117-52001139 GGTTTTTCAAAGATAGCATTTGG + Intronic
1118532655 14:66724396-66724418 GTATTTTCTCAGACAGAGTTTGG - Intronic
1118581993 14:67310257-67310279 GTTTTTTCACATCTAGAATGAGG + Intronic
1119962506 14:78875720-78875742 CTCTTTTCACAGATATAACTGGG - Intronic
1119973486 14:78999080-78999102 ATGTTTTCAAACAAAGAATTTGG + Intronic
1120544470 14:85793295-85793317 ATTTATTCACTGATAGAATTAGG + Intergenic
1124913709 15:33948034-33948056 ATGTTTTCAGAGATAGCATGTGG - Intronic
1125006998 15:34828005-34828027 GTGTTGTCACATAGATAATTGGG - Intergenic
1125111873 15:36043708-36043730 GTGTGTTCTCACATATAATTGGG + Intergenic
1126694882 15:51317467-51317489 TTGTTTTCTCAGTTAGGATTAGG - Intronic
1126812715 15:52423886-52423908 GGTCTTTCACAGATAGTATTAGG - Intronic
1127190917 15:56529671-56529693 GTGTTATCAAAGATAGGCTTTGG + Intergenic
1127440169 15:58998965-58998987 GTTTTTTCACTGATAGTATGAGG + Intronic
1128180549 15:65599997-65600019 GTGTTTTCACTGCTAGAAAGGGG + Intronic
1128879655 15:71231507-71231529 GTCTTTTCACAGATGGATTCAGG - Intronic
1129044829 15:72725553-72725575 CTGTTTTCAGAGATATTATTAGG + Intronic
1130754225 15:86745648-86745670 GTTTCTTCACAGATAAAATCGGG - Intronic
1130763247 15:86842742-86842764 GTGTTCTCCCAGAGAGCATTTGG - Intronic
1131801586 15:96074815-96074837 GTGTTTTTGCAAATACAATTTGG + Intergenic
1132918413 16:2368093-2368115 GTGTTTAAAAAGATAGAATAGGG - Intergenic
1133733533 16:8596478-8596500 TTGTTTTCACCAATAGAATTTGG + Intergenic
1134189142 16:12107885-12107907 GTGTTTTAAGTGATAGAATTAGG + Intronic
1135043196 16:19133696-19133718 ATAATTTCACAGATAGAGTTTGG - Intronic
1135460044 16:22634406-22634428 GTGTTATCCAGGATAGAATTTGG - Intergenic
1136933642 16:34439099-34439121 GTGTTTTCACATTTAGGAGTTGG + Intergenic
1136970930 16:34972715-34972737 GTGTTTTCACATTTAGGAGTTGG - Intergenic
1137037489 16:35578787-35578809 GTGTTTTCACATATTTTATTGGG - Intergenic
1140183250 16:72741905-72741927 GGGTTTTCACAGGCAGAATGTGG - Intergenic
1140568271 16:76070362-76070384 TTGTTTTTATAGATAGTATTGGG + Intergenic
1141270412 16:82535140-82535162 TTGTTTTCTGAGATGGAATTTGG + Intergenic
1141886322 16:86894862-86894884 GTGTCTTTGCAGATATAATTGGG + Intergenic
1142587297 17:981251-981273 GTCTTTTCACAAATGGAGTTTGG - Intergenic
1142734734 17:1889665-1889687 TTGTTTTCAATGATAGAACTAGG + Intronic
1143751665 17:9032645-9032667 GTGTTTACAGATACAGAATTTGG + Intronic
1146360406 17:32171031-32171053 TTCTTTTCACAGCTAGAGTTGGG + Exonic
1147453803 17:40522003-40522025 GTTTTTTCATAGGTAGAATAAGG + Intergenic
1149081792 17:52666607-52666629 GTGTTTTAGGAGAAAGAATTGGG + Intergenic
1153109179 18:1563200-1563222 GTGATCTCATAGATAGATTTAGG + Intergenic
1154963263 18:21330694-21330716 GTTTTTTCAAAGAGAGACTTAGG - Intronic
1158172896 18:54619183-54619205 GTCTTTTCAAAAATACAATTAGG - Intergenic
1159334133 18:67041925-67041947 TTGTTTTCAGAGATATACTTAGG + Intergenic
1159378277 18:67622570-67622592 GGGTTCTCATAGATAGAATAAGG - Intergenic
1159622839 18:70658511-70658533 GGGTTTTCAAAGCTAAAATTTGG - Intergenic
1160263541 18:77318339-77318361 GAATTTTCAGAGATAGAATAAGG + Intergenic
1163067719 19:14811501-14811523 GAGTCTTTACAGATACAATTAGG - Intronic
1165066402 19:33231421-33231443 GTGTTTTTAGAGATAGGATCTGG - Intergenic
1165622071 19:37256658-37256680 GAGTTTGCACAGATGTAATTTGG + Intergenic
1165633684 19:37322875-37322897 GAGTTTGCACAGATGTAATTTGG + Intronic
1165669049 19:37659778-37659800 GTATTATCACTGATTGAATTTGG + Intronic
1166808595 19:45501537-45501559 TTGTTTTCCCAGCTTGAATTGGG - Intronic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
926078146 2:9959492-9959514 TTGTGTTCACAGATAGGATTTGG + Intronic
927066482 2:19476476-19476498 GTGTTCTCTCAGGTTGAATTTGG - Intergenic
927828269 2:26325032-26325054 GTATTTGCACAAATACAATTTGG + Intronic
928065753 2:28163088-28163110 GTGTGTAGACAGATAGAATGAGG + Intronic
931197770 2:60069104-60069126 GTGTCTCCACAGATAGACTTGGG + Intergenic
933907645 2:86911138-86911160 TTGTTTTCACATATATAATGTGG + Intronic
933908893 2:86920853-86920875 TTGTTTTCACATATATAATGTGG + Intronic
934023832 2:87982532-87982554 TTGTTTTCACATATATAATGTGG - Intergenic
934076245 2:88430977-88430999 GTGTTGTTACAGATAGAACAAGG - Intergenic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
936601043 2:113894755-113894777 GTTTTTTCACTTATAAAATTAGG - Intronic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
937821876 2:126319306-126319328 TTTTTTTCACACATAAAATTGGG - Intergenic
938943926 2:136193394-136193416 GTTTTTACACAGAAAGAAGTGGG - Intergenic
939431719 2:142118032-142118054 ATGGTTTCACAGAGAGAAATAGG - Intronic
939672658 2:145032651-145032673 GTATTTTCACAGTTTGAAATTGG + Intergenic
941319065 2:164031829-164031851 GAGTTTTGACCAATAGAATTTGG - Intergenic
941404045 2:165067012-165067034 ATGTTTTCTCAGAAAGAATTGGG + Intergenic
941862105 2:170293465-170293487 ATGTTTTCACAGATATTTTTTGG + Intronic
942273291 2:174298846-174298868 GTTTTCTCACCGCTAGAATTAGG - Intergenic
942700934 2:178709691-178709713 GTTATTTCACAGTTAGAAGTTGG + Exonic
942773602 2:179553091-179553113 ATGTTTTCACCTATACAATTTGG - Intronic
943461715 2:188177200-188177222 GTATTTTCAAAAATATAATTTGG - Intergenic
944361437 2:198862082-198862104 ATGTTTTCACACACAGAATATGG - Intergenic
945610544 2:211995848-211995870 GTGCTATCATAGATAGAATATGG - Intronic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
948227150 2:236320167-236320189 GTGCTTTCACACATATATTTTGG + Intergenic
948642930 2:239386786-239386808 GTGTTTTCACTGTTAGAACTGGG - Intronic
1170298023 20:14850713-14850735 GTGTTTTCTTAGTTGGAATTAGG + Intronic
1170891604 20:20380831-20380853 GTTTTCTCACTGATAAAATTAGG + Intergenic
1172604917 20:36207733-36207755 GTGGTTTCACAGCCTGAATTGGG - Intronic
1173363309 20:42363791-42363813 GTGTCTTCACAGATAGGAAGAGG + Intronic
1173379466 20:42526584-42526606 GTGTTGTCACAGATAAAAACTGG - Intronic
1174101677 20:48131448-48131470 TTGTTTTTAAAAATAGAATTGGG + Intergenic
1178661136 21:34508813-34508835 GTGTTCTCACACATAGAAGCAGG + Intergenic
1180153683 21:45966648-45966670 GTGTTATCACATATATAAATGGG + Intergenic
1180178598 21:46105907-46105929 GTCTTTTAACAGAGAGAGTTTGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183126487 22:35786838-35786860 GTGATTTCACATATGAAATTGGG - Intronic
949724226 3:7024824-7024846 GATTTTTCACAGGTAGAAGTAGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
952734951 3:36680427-36680449 GTTATTTCCAAGATAGAATTAGG + Intergenic
952900799 3:38110397-38110419 GTGTTTTTACAGGTAGACATGGG + Intronic
952999851 3:38922629-38922651 TTGTTTTCCCAGGTAGATTTAGG - Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
955178612 3:56643460-56643482 GTGTTTTAAAAGTTAGAATATGG + Intronic
957990919 3:87626625-87626647 ATGCTTTGACAAATAGAATTGGG + Intergenic
959473623 3:106783425-106783447 CTGTCTTAACAGATTGAATTTGG - Intergenic
959655432 3:108799165-108799187 GTGTCTTCACTGATAGAAGAGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
959988574 3:112604771-112604793 GTGTTTTTTCAGATATAAATCGG - Exonic
960600776 3:119456205-119456227 GTGTTTTAAAAGAAAGAAGTTGG - Intronic
961527426 3:127514536-127514558 GTGTTTTTAAATATAAAATTTGG - Intergenic
961924129 3:130458746-130458768 GTGTTTTGTCAGATAGATGTTGG - Intronic
963346958 3:144106327-144106349 GTGGTTTCACAGATGAAATCTGG + Intergenic
963377041 3:144480631-144480653 GTGTTTTTCCAGATTGTATTTGG + Intergenic
963428760 3:145168262-145168284 GTGTTCCCAGAGATAGAAGTTGG + Intergenic
964914297 3:161820691-161820713 TTGTTTTAACAGATAAAATCAGG + Intergenic
965216571 3:165871669-165871691 GTGGCTTCACAGAATGAATTAGG + Intergenic
967466996 3:189819087-189819109 GTGTTTTCATAGTAGGAATTTGG + Intronic
967924513 3:194635551-194635573 GTGTTTTCAAAGTTATGATTTGG + Intergenic
968284945 3:197503000-197503022 GGGTTTTGACAGATAGAAACAGG - Intergenic
968855024 4:3113709-3113731 GTGTTTTCTCAGGGAGAAATTGG + Intronic
969075828 4:4576933-4576955 GTGATTTCACAGAAATGATTGGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
969920418 4:10533383-10533405 GTGTTTTCACTGACAGAACTGGG - Intronic
972208743 4:36811288-36811310 GTGTTTTCACTGACAGGAATGGG - Intergenic
972974014 4:44611287-44611309 GCGTTTCTAAAGATAGAATTAGG - Intergenic
973879837 4:55258864-55258886 ATGTTTTAACAGATATCATTGGG - Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
975041497 4:69749728-69749750 TTGTTTTCCCAGAAAGATTTAGG + Exonic
976057929 4:81090769-81090791 GTGTTCTCACATATATAAGTGGG - Intronic
977875072 4:102140020-102140042 CTGCTTTCACAGATAGACATAGG + Intergenic
978003726 4:103590705-103590727 TTTTTTTCACAAGTAGAATTGGG - Intronic
978503200 4:109431460-109431482 GTTTCTTCACAGATAAAATAGGG + Intergenic
978829222 4:113063224-113063246 GTGTTTTAAATGATAGCATTTGG + Intronic
979770464 4:124518430-124518452 GTGTTATCACAAATATATTTTGG - Intergenic
979943309 4:126791303-126791325 CTGTTTTGACAGGGAGAATTGGG + Intergenic
980057793 4:128095711-128095733 TTTTTTTCAAAGATAGAATTTGG + Intronic
980412642 4:132443424-132443446 GTGTTTCCACAGATAATCTTTGG + Intronic
983718294 4:170814269-170814291 TTGATTTCACAGATAGTATGTGG + Intergenic
984439028 4:179742128-179742150 CTGTTTTCATAGGTAAAATTTGG - Intergenic
987280283 5:16406863-16406885 GTGTTTACCCTGATATAATTTGG + Intergenic
987732290 5:21790110-21790132 GAGTTTTCCCAGATAAGATTGGG + Intronic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988203500 5:28100600-28100622 GTGTTTGCACTGATATTATTGGG + Intergenic
988347331 5:30055501-30055523 GAGGTTTCTCAGATAGAACTAGG - Intergenic
989001800 5:36768722-36768744 TTGTTTTGACAAATAGAATGTGG - Intergenic
990157255 5:52891781-52891803 GTGATTTAAAAAATAGAATTAGG + Intronic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
992369983 5:76133454-76133476 GTGTTGTCACAGAACAAATTAGG - Intronic
992471719 5:77063280-77063302 GTTTTTTTAAAAATAGAATTTGG + Exonic
992792561 5:80226625-80226647 GTGTTCTCGCAGAAAGCATTGGG - Intronic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993866898 5:93206413-93206435 GTGTCTTCACCTATAGAATGAGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
996984488 5:129542645-129542667 GTGTTTTATGAGATAAAATTTGG + Intronic
1000191274 5:158913449-158913471 GTGTTTTCAGAAATAGCCTTTGG + Intronic
1000412784 5:160950983-160951005 GTGTTTCCAGAGATAGAAAATGG + Intergenic
1000948669 5:167453309-167453331 GTGTTTTCTTAGATAAAAATTGG - Intronic
1002508404 5:179696842-179696864 GTGTTTTTACAAATTGAATGTGG + Intronic
1003428694 6:6019036-6019058 GTGTTTTGACAGATGCAAATTGG + Intergenic
1006259705 6:32857598-32857620 CTGTGTTCACATATAGAATGTGG - Intronic
1006656899 6:35603048-35603070 GTTTCTTCACTGATAGAATGTGG + Intronic
1006967721 6:38006298-38006320 GTGTTTGCTGTGATAGAATTTGG + Intronic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1009486505 6:64230261-64230283 TTGTTTCCACAGAGACAATTAGG - Intronic
1009551762 6:65105626-65105648 GTGGTTTCACAGACAGGATTAGG - Intronic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1012303329 6:97618072-97618094 GTGTCTGCACAGACAGAATCTGG + Intergenic
1012450387 6:99348792-99348814 GTGTTTGCAACAATAGAATTGGG - Intronic
1012635529 6:101534528-101534550 GAGTTTCCACAGATTGCATTAGG - Intronic
1014219287 6:118784172-118784194 TTGTTTTACCAGAGAGAATTAGG + Intergenic
1015302515 6:131669836-131669858 GTGTTTTCTCAAATAGACATGGG - Intronic
1017210343 6:151848685-151848707 ATCTTTTCAGAGATACAATTGGG + Intronic
1020334738 7:7054141-7054163 GTATTTACACAGAAAGAAGTAGG + Intergenic
1020913089 7:14158237-14158259 GTGTTGTCTCAGATAGAAGAGGG - Intronic
1021459036 7:20864857-20864879 GTGTGTTCACAGAAAGAGTGAGG - Intergenic
1022120191 7:27300635-27300657 TTATTTTCACAGAGAAAATTTGG - Intergenic
1022125257 7:27350019-27350041 CTGTTTTGACTAATAGAATTTGG + Intergenic
1023564632 7:41511730-41511752 TGGTTTTCACAGACAAAATTAGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024064170 7:45718918-45718940 GGTTTTTCACAGATGGATTTGGG + Exonic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026466789 7:70661301-70661323 GGGGCTTCACAGGTAGAATTAGG + Intronic
1027334002 7:77128979-77129001 GTAGTTTCAAACATAGAATTAGG - Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1027775258 7:82457080-82457102 GTGTTATCACCCATAGAATTTGG + Intergenic
1028772854 7:94646995-94647017 GTGTGTACACACATAGAATATGG - Intronic
1028977728 7:96932692-96932714 GATTTTTCACAGTTGGAATTTGG + Intergenic
1030746965 7:113177353-113177375 GGTTTTTCAGAGATAGAATGAGG + Intergenic
1030845156 7:114400586-114400608 GTGTTTCCACAGACAGGAGTCGG + Intronic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1034919529 7:155068563-155068585 GTGTTTTTCAAGATAAAATTGGG + Exonic
1035071049 7:156145188-156145210 AATTTTTCAAAGATAGAATTGGG - Intergenic
1035252592 7:157606827-157606849 GTGTTTTAACTGATTGAACTAGG + Intronic
1035951351 8:4025013-4025035 GTGATTACATAGGTAGAATTAGG + Intronic
1036194829 8:6705051-6705073 TTGTTTTTACAGAAATAATTGGG - Intergenic
1036558756 8:9883958-9883980 GCGTATTCACAGATACAAGTGGG - Intergenic
1037038040 8:14192424-14192446 GTGTTTTCTCATGTATAATTTGG + Intronic
1038156616 8:24997490-24997512 GTGTTTTTAAACATAGAATGAGG - Intergenic
1038338885 8:26667610-26667632 GAGTTTTCAGAGAAAGAGTTGGG - Intergenic
1038761787 8:30391222-30391244 GGGTTTTCACCATTAGAATTTGG + Intronic
1041197818 8:55418617-55418639 GTGTTTTCACAGAATCATTTGGG - Intronic
1041827865 8:62118396-62118418 GTCTTTTCACAGACAGTTTTTGG + Intergenic
1041869736 8:62619130-62619152 GTGTTTTCACAGATGAAAGCAGG - Intronic
1042012319 8:64261117-64261139 GTTTTTTAACAGATAATATTCGG + Intergenic
1042495723 8:69452857-69452879 ATGTTTGCACAGAAAGGATTTGG + Intergenic
1044246486 8:89952774-89952796 GTGTTTTCATAGATCAAAGTGGG + Intronic
1045648907 8:104325109-104325131 GTTTTCTCACATATAAAATTGGG + Intergenic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1047171249 8:122495169-122495191 GAGCTTTCACAGAGAGACTTTGG + Intergenic
1047353197 8:124095432-124095454 GTGTGGTTACAGATAGATTTTGG - Intronic
1047516941 8:125563329-125563351 ATGTTTTTACGGATAAAATTTGG + Intergenic
1047615485 8:126558883-126558905 GTGTTTTCAGAGTTAGTAGTGGG + Intergenic
1047991298 8:130289329-130289351 GTGTGTTCACAGTAAGAATGTGG + Intronic
1049005978 8:139855941-139855963 ATGTTGAGACAGATAGAATTGGG + Intronic
1049979282 9:889256-889278 GAATTTTAACATATAGAATTCGG + Intronic
1054862072 9:69964455-69964477 GGGTTTCCACATATAGATTTTGG - Intergenic
1055006285 9:71510919-71510941 TTGTTTATACACATAGAATTTGG - Intergenic
1057129445 9:92642800-92642822 GTGTTTTCACAGGTAGCAACTGG - Exonic
1059690966 9:116686180-116686202 GTGGGTTCTCAGATAGAATTGGG + Intronic
1060433183 9:123568624-123568646 GTGTTTACAAAGATAAAAGTGGG + Intronic
1061355481 9:130101614-130101636 GAGTTTCCACAGGTAGAATATGG + Intronic
1187222081 X:17337912-17337934 GAGTTTTCAAAGATGGAAGTGGG - Intergenic
1188586580 X:31783590-31783612 TTGTTTTCACAATTAGAATGAGG + Intronic
1189186189 X:39057455-39057477 GTGCTTGCAGAGAAAGAATTTGG + Intergenic
1190299388 X:49047727-49047749 GGGTTTTTAGAGATAGAGTTCGG + Intergenic
1191027194 X:55926372-55926394 GTGTATTTACAGATAGGAATTGG + Intergenic
1192960429 X:76124677-76124699 GTGGTTTCAAGGATGGAATTGGG + Intergenic
1193658812 X:84231685-84231707 GTGTTTATACAGAAATAATTGGG - Intergenic
1194539262 X:95150396-95150418 GTCTTTTCACAGTTTGATTTGGG + Intergenic
1194828018 X:98586434-98586456 TTGTCTTCACAGAGTGAATTGGG + Intergenic
1195124462 X:101792416-101792438 GTGTTTTCAAAAATATTATTTGG + Intergenic
1195932217 X:110089964-110089986 GTGTACTCACTGTTAGAATTTGG + Intronic
1196968213 X:121081139-121081161 GTACTCTCACAAATAGAATTTGG - Intergenic
1197671197 X:129279954-129279976 GTGGCTTCACAGAATGAATTAGG + Intergenic
1199697361 X:150352316-150352338 GTGGTTTCACAGATAGACCAGGG + Intergenic
1199886493 X:152026424-152026446 GTGTTTTCCCATCAAGAATTTGG - Intergenic
1200842319 Y:7795353-7795375 ATGGTTTCACAGACAGAGTTTGG + Intergenic
1201571616 Y:15421453-15421475 GTGTATTGACAGAGAGACTTCGG - Intergenic