ID: 987816074

View in Genome Browser
Species Human (GRCh38)
Location 5:22902088-22902110
Sequence GCCTCCTTGTCCCTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816074_987816078 1 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816078 5:22902112-22902134 TCCCAGGCCCCTGAGTGCCCAGG No data
987816074_987816088 28 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816074_987816089 29 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG No data
987816074_987816084 10 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
987816074_987816085 11 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816074 Original CRISPR GCCTCCTTGTCCCTGCAGGC TGG (reversed) Intergenic
No off target data available for this crispr