ID: 987816075

View in Genome Browser
Species Human (GRCh38)
Location 5:22902092-22902114
Sequence GGAGGCCTCCTTGTCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816075_987816088 24 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816075_987816090 28 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816075_987816089 25 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG No data
987816075_987816084 6 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
987816075_987816085 7 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data
987816075_987816078 -3 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816078 5:22902112-22902134 TCCCAGGCCCCTGAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816075 Original CRISPR GGAGGCCTCCTTGTCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr