ID: 987816077

View in Genome Browser
Species Human (GRCh38)
Location 5:22902110-22902132
Sequence TGGGCACTCAGGGGCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816077_987816089 7 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG No data
987816077_987816090 10 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816077_987816088 6 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816077_987816092 27 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816077 Original CRISPR TGGGCACTCAGGGGCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr