ID: 987816080

View in Genome Browser
Species Human (GRCh38)
Location 5:22902114-22902136
Sequence TTCCTGGGCACTCAGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816080_987816092 23 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816080_987816089 3 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG No data
987816080_987816088 2 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816080_987816090 6 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816080_987816094 30 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816094 5:22902167-22902189 TGCAGCTGCGCCCAGGAGCAGGG No data
987816080_987816093 29 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816080 Original CRISPR TTCCTGGGCACTCAGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr