ID: 987816082

View in Genome Browser
Species Human (GRCh38)
Location 5:22902120-22902142
Sequence CAGACATTCCTGGGCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816082_987816092 17 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG No data
987816082_987816096 26 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816082_987816093 23 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816082_987816094 24 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816094 5:22902167-22902189 TGCAGCTGCGCCCAGGAGCAGGG No data
987816082_987816088 -4 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816082_987816090 0 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816082_987816089 -3 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG No data
987816082_987816095 25 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816095 5:22902168-22902190 GCAGCTGCGCCCAGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816082 Original CRISPR CAGACATTCCTGGGCACTCA GGG (reversed) Intergenic