ID: 987816084

View in Genome Browser
Species Human (GRCh38)
Location 5:22902121-22902143
Sequence CCTGAGTGCCCAGGAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816074_987816084 10 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
987816068_987816084 26 Left 987816068 5:22902072-22902094 CCGGAGCAGGCACTTCCCAGCCT No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
987816072_987816084 11 Left 987816072 5:22902087-22902109 CCCAGCCTGCAGGGACAAGGAGG No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
987816075_987816084 6 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816084 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816084 Original CRISPR CCTGAGTGCCCAGGAATGTC TGG Intergenic
No off target data available for this crispr