ID: 987816085

View in Genome Browser
Species Human (GRCh38)
Location 5:22902122-22902144
Sequence CTGAGTGCCCAGGAATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816075_987816085 7 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data
987816074_987816085 11 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data
987816072_987816085 12 Left 987816072 5:22902087-22902109 CCCAGCCTGCAGGGACAAGGAGG No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data
987816068_987816085 27 Left 987816068 5:22902072-22902094 CCGGAGCAGGCACTTCCCAGCCT No data
Right 987816085 5:22902122-22902144 CTGAGTGCCCAGGAATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816085 Original CRISPR CTGAGTGCCCAGGAATGTCT GGG Intergenic
No off target data available for this crispr