ID: 987816086

View in Genome Browser
Species Human (GRCh38)
Location 5:22902129-22902151
Sequence CTCTGGACCCAGACATTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816086_987816092 8 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816086_987816094 15 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816094 5:22902167-22902189 TGCAGCTGCGCCCAGGAGCAGGG No data
987816086_987816095 16 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816095 5:22902168-22902190 GCAGCTGCGCCCAGGAGCAGGGG No data
987816086_987816090 -9 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816086_987816093 14 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816086_987816096 17 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816086 Original CRISPR CTCTGGACCCAGACATTCCT GGG (reversed) Intergenic
No off target data available for this crispr