ID: 987816087

View in Genome Browser
Species Human (GRCh38)
Location 5:22902130-22902152
Sequence GCTCTGGACCCAGACATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816087_987816090 -10 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816087_987816094 14 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816094 5:22902167-22902189 TGCAGCTGCGCCCAGGAGCAGGG No data
987816087_987816096 16 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816087_987816092 7 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG No data
987816087_987816095 15 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816095 5:22902168-22902190 GCAGCTGCGCCCAGGAGCAGGGG No data
987816087_987816093 13 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816087 Original CRISPR GCTCTGGACCCAGACATTCC TGG (reversed) Intergenic