ID: 987816088

View in Genome Browser
Species Human (GRCh38)
Location 5:22902139-22902161
Sequence TCTGGGTCCAGAGCTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816079_987816088 3 Left 987816079 5:22902113-22902135 CCCAGGCCCCTGAGTGCCCAGGA No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816072_987816088 29 Left 987816072 5:22902087-22902109 CCCAGCCTGCAGGGACAAGGAGG No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816081_987816088 -3 Left 987816081 5:22902119-22902141 CCCCTGAGTGCCCAGGAATGTCT No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816077_987816088 6 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816074_987816088 28 Left 987816074 5:22902088-22902110 CCAGCCTGCAGGGACAAGGAGGC No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816083_987816088 -5 Left 987816083 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816080_987816088 2 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816075_987816088 24 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data
987816082_987816088 -4 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816088 Original CRISPR TCTGGGTCCAGAGCTGCAGC TGG Intergenic
No off target data available for this crispr