ID: 987816090

View in Genome Browser
Species Human (GRCh38)
Location 5:22902143-22902165
Sequence GGTCCAGAGCTGCAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816081_987816090 1 Left 987816081 5:22902119-22902141 CCCCTGAGTGCCCAGGAATGTCT No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816077_987816090 10 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816087_987816090 -10 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816086_987816090 -9 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816080_987816090 6 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816083_987816090 -1 Left 987816083 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816082_987816090 0 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816079_987816090 7 Left 987816079 5:22902113-22902135 CCCAGGCCCCTGAGTGCCCAGGA No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data
987816075_987816090 28 Left 987816075 5:22902092-22902114 CCTGCAGGGACAAGGAGGCCTCC No data
Right 987816090 5:22902143-22902165 GGTCCAGAGCTGCAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816090 Original CRISPR GGTCCAGAGCTGCAGCTGGG TGG Intergenic
No off target data available for this crispr