ID: 987816091

View in Genome Browser
Species Human (GRCh38)
Location 5:22902146-22902168
Sequence CAGCCACCCAGCTGCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816091_987816096 0 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816091_987816103 30 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816103 5:22902199-22902221 CCCTTTAACTAGTTAGGGAGTGG No data
987816091_987816095 -1 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816095 5:22902168-22902190 GCAGCTGCGCCCAGGAGCAGGGG No data
987816091_987816092 -9 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG No data
987816091_987816101 25 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816101 5:22902194-22902216 CCTGTCCCTTTAACTAGTTAGGG No data
987816091_987816093 -3 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816091_987816094 -2 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816094 5:22902167-22902189 TGCAGCTGCGCCCAGGAGCAGGG No data
987816091_987816099 24 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816099 5:22902193-22902215 ACCTGTCCCTTTAACTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816091 Original CRISPR CAGCCACCCAGCTGCAGCTC TGG (reversed) Intergenic