ID: 987816092

View in Genome Browser
Species Human (GRCh38)
Location 5:22902160-22902182
Sequence GGGTGGCTGCAGCTGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1362
Summary {0: 5, 1: 55, 2: 185, 3: 349, 4: 768}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816087_987816092 7 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816079_987816092 24 Left 987816079 5:22902113-22902135 CCCAGGCCCCTGAGTGCCCAGGA No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816086_987816092 8 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816082_987816092 17 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816083_987816092 16 Left 987816083 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816081_987816092 18 Left 987816081 5:22902119-22902141 CCCCTGAGTGCCCAGGAATGTCT No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816091_987816092 -9 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816077_987816092 27 Left 987816077 5:22902110-22902132 CCTCCCAGGCCCCTGAGTGCCCA No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768
987816080_987816092 23 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG 0: 5
1: 55
2: 185
3: 349
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816092 Original CRISPR GGGTGGCTGCAGCTGCGCCC AGG Intergenic
900233888 1:1577418-1577440 GGGCAGATGCAGCTGCTCCCAGG - Intergenic
900516860 1:3086278-3086300 GGGTCGCAGCAGGTGCGCCCAGG - Intronic
900602216 1:3507822-3507844 GGGGGCCTGCCGCTGCCCCCCGG - Exonic
900997525 1:6130473-6130495 GGGTGGCCACAGCTGCACTCAGG + Intronic
901403690 1:9031959-9031981 TGGAGGCTGCAGCTGCACCTGGG + Intergenic
901403768 1:9032296-9032318 GGGTGGCTGCAGTGGCACCCGGG + Intergenic
901483156 1:9539806-9539828 GGGAGGCTGGGGCCGCGCCCGGG - Intronic
901936496 1:12630530-12630552 GGGTAGCTGCACCTGCACCCAGG - Intergenic
902525856 1:17056801-17056823 GGGCGGCTGTACCTCCGCCCTGG + Intergenic
902585672 1:17437797-17437819 CCGTGGCCGCCGCTGCGCCCGGG - Intronic
902618084 1:17634789-17634811 GGGTGGCTGCAGCCTCTCCAGGG + Intronic
903101619 1:21035369-21035391 GAGTGGCTGGAGCTGTGCCTGGG - Intronic
903689325 1:25160213-25160235 GGGTGGTGGCAGCTGCTCCCAGG - Intergenic
903750276 1:25617034-25617056 GGGCGGCTGCAGATGCGCCCGGG - Intergenic
903853364 1:26321240-26321262 GGGTGAGTGCAGCAGAGCCCTGG + Intergenic
904365823 1:30010424-30010446 GGATGGCTGCAGCAGCACCCAGG + Intergenic
904369948 1:30042123-30042145 GGGTGGCTGCAGCTGCACATGGG - Intergenic
904404094 1:30274917-30274939 AGGTGGCTGCAGCTGCACCCAGG + Intergenic
904500383 1:30909384-30909406 GTGTGGAAGCAGCTGCGCTCAGG - Intergenic
904838555 1:33355231-33355253 GTGTGGCTGCAGCTGAGCATAGG + Exonic
904984405 1:34533105-34533127 AGGTGGCTGCAGTTTTGCCCTGG - Intergenic
905001166 1:34671245-34671267 GGGTGGCCACAGCTGCACCTAGG - Intergenic
905046833 1:35010874-35010896 GGCTGGCTGCAGCAGAGCCACGG + Exonic
905107732 1:35574165-35574187 AGGAGGCTGCGGCTGCGCCAGGG - Exonic
905215292 1:36402125-36402147 GGGTTGCTGCAGCTGTGCCCAGG + Intergenic
905248194 1:36629174-36629196 GGGAGGAGGCAGCTGGGCCCTGG + Intergenic
905545936 1:38800887-38800909 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
905839370 1:41162041-41162063 GGGTGGCTGCAGCTGCACCCAGG - Intronic
905865159 1:41372485-41372507 AGGTCACTGCAGCTGCTCCCAGG + Intronic
906051916 1:42881173-42881195 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
906548766 1:46643277-46643299 GGCTGGCTGCAGCTTCCCCTCGG + Exonic
907369765 1:53993117-53993139 GGGTGGCTGCGGCTGCACCTGGG + Intergenic
907603549 1:55793922-55793944 GGGTGGCTGTAGCTCTGCCCAGG - Intergenic
907761672 1:57367760-57367782 GGGTGGCTGCAGCTGCATGTGGG - Intronic
907761689 1:57367841-57367863 GGGAGGCTGCAGCTGTGCCTGGG - Intronic
907761707 1:57367922-57367944 GGGCGGCTGCAGCTGCACCCAGG - Intronic
907985231 1:59523993-59524015 GGGCGGCTGCAGATGTGCCTGGG - Intronic
908259430 1:62327875-62327897 GGGTAGCTGTAGCTGCACCCAGG + Intergenic
909054742 1:70807411-70807433 GAGTGACTGCAGCTTCACCCAGG + Intergenic
909238423 1:73181316-73181338 GGGCGGCTGCAGCTGCAAACGGG + Intergenic
909392380 1:75132380-75132402 GGGTGCGCGCAGCTGCACCCCGG + Intronic
909788052 1:79640799-79640821 GGGTGGCAGCAGCTGCTGCATGG + Intergenic
910101638 1:83583677-83583699 GGGTAGCTGCAGCTGAGCCTGGG + Intergenic
910259736 1:85283767-85283789 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
910602239 1:89043977-89043999 GGGTGGCTGCAGCTGCGGCTTGG + Intergenic
910602242 1:89043998-89044020 GGGTGGCTGCAGCTGCAGCTTGG + Intergenic
910602260 1:89044101-89044123 GGGCAGCTGCAGCTGCGCCCAGG + Intergenic
910936186 1:92485719-92485741 AGGCGGCGGCAGCTGCGCTCGGG - Intronic
911154275 1:94623596-94623618 GGGAGGCTGGGGCTGCTCCCAGG - Intergenic
911266718 1:95752860-95752882 AGGCGGCTGCAGCTGCGCCTGGG + Intergenic
911288772 1:96029197-96029219 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
911288792 1:96029287-96029309 GGGCGGCTGCAACTGTGCTCAGG + Intergenic
911475494 1:98367568-98367590 GGGAGGCTGCAGCTGTGCCCAGG + Intergenic
911935265 1:103961201-103961223 GCTGGGCTGCAGCTGTGCCCAGG + Intergenic
912008507 1:104932548-104932570 GGGTGGTTGCAGCTGTGCCCAGG - Intergenic
912013847 1:105006071-105006093 GGGCAGCTGCAGCTACACCCAGG + Intergenic
912093657 1:106113751-106113773 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
912094361 1:106120729-106120751 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
912132391 1:106619302-106619324 GGGTGGCTGCAGTGGCACCAAGG - Intergenic
912132415 1:106619389-106619411 GGGTGGCTGAAGATGCACCCAGG - Intergenic
912132429 1:106619470-106619492 GCATGGCTGCAGCTGTGCTCAGG - Intergenic
912713260 1:111964463-111964485 GGGTGGGGGCAGCAGAGCCCTGG + Intronic
912795784 1:112692757-112692779 GGCTGTCTCCAGCTGGGCCCTGG - Exonic
913103787 1:115594045-115594067 GGGCAGCTGCTGCTGAGCCCAGG + Intergenic
913131216 1:115839385-115839407 GGCAGGCTGCAGCTGTCCCCGGG + Exonic
913592523 1:120342270-120342292 GGGCGGCGGCAGCCGTGCCCAGG + Intergenic
913650827 1:120912860-120912882 GGGCGGCGGCAGCCGTGCCCAGG - Intergenic
914170285 1:145216207-145216229 GGGCGGCGGCAGCCGTGCCCAGG + Intergenic
914525403 1:148460173-148460195 GGGCGGCGGCAGCCGTGCCCAGG + Intergenic
914598271 1:149175657-149175679 GGGCGGCGGCAGCCGTGCCCAGG - Intergenic
914640998 1:149606955-149606977 GGGCGGCGGCAGCCGTGCCCAGG - Intergenic
915168932 1:153964174-153964196 GGGGTGCTGAAGCCGCGCCCAGG + Intronic
915252350 1:154599669-154599691 GAGTGGCTGCAGCTGCAGCCAGG - Intronic
915268154 1:154733317-154733339 GGGGGGCTGCAGGTGGGACCTGG - Intronic
915828856 1:159106194-159106216 GGGTGGCTGCAGCCATGCCCAGG + Intronic
916648982 1:166817170-166817192 GGGAGGCTGCAGCTGCACCCAGG + Intergenic
916773550 1:167936754-167936776 CGGTGGCAGCAGCGGCGCCTGGG - Intronic
916966247 1:169945367-169945389 GGGCGGCTGCAGCTGTGCCCAGG + Intronic
917848914 1:179043372-179043394 GGGTGGCTGCAGCTGTACCCAGG + Intronic
919083326 1:192891773-192891795 GGGCAGCTGTAGCTGCGCCCAGG + Intergenic
919083341 1:192891850-192891872 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
919165410 1:193885445-193885467 GTAGGGCTGCAGCTGCACCCAGG + Intergenic
919191904 1:194230937-194230959 GGGTGGCTGCATCAGCACCCAGG + Intergenic
919205833 1:194420824-194420846 GGGTGGCTGCAGCTGCATCCAGG + Intergenic
919249260 1:195031021-195031043 GGGCAGCTGTAGCTGTGCCCAGG + Intergenic
919263909 1:195237393-195237415 GGGTGGCTACAGCTGCCCCCAGG - Intergenic
919302652 1:195790687-195790709 GGGTAGCTGTAGCTGTGCCCAGG - Intergenic
919453888 1:197801013-197801035 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
919751716 1:201041850-201041872 GGGAGGCTGCAGCTGGGCCTTGG - Intronic
919943512 1:202304289-202304311 GGATGGCTGGAGCAGAGCCCTGG + Intronic
920269413 1:204752078-204752100 GGGCGGCTACAGCAGCACCCAGG - Intergenic
921097690 1:211901449-211901471 GGGTGGCTGTAGCTGCACCCAGG - Intergenic
921625278 1:217372709-217372731 GAGTGGCTGCAGCTGTGTCTGGG - Intergenic
921767035 1:218983916-218983938 GGGTGGCTGCAGCTGCAGACCGG - Intergenic
922141800 1:222894658-222894680 GGGTGGCTGTAGCTGCGCCTGGG + Intronic
923328047 1:232898209-232898231 GGGAGGCTGCAGCTATGCCCAGG - Intergenic
923755165 1:236785422-236785444 GGATGGCAGCAGCTGCTCTCGGG - Intergenic
923918073 1:238530670-238530692 GGGAAGCTGCACCTGCGCCCAGG + Intergenic
924672943 1:246147731-246147753 GGGAGGCTGCAGCTCTACCCTGG - Intronic
924679828 1:246220431-246220453 GGTCAGCTGCAGCTGTGCCCAGG - Intronic
1062770140 10:92549-92571 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1062771595 10:105324-105346 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1062771640 10:105505-105527 GAGTGGCTGCAGCAGCACCCAGG + Intergenic
1064031902 10:11887846-11887868 AGGTGTGAGCAGCTGCGCCCTGG - Intergenic
1064392065 10:14950828-14950850 GTGTGGCTGGAACTGCACCCAGG + Intronic
1065365904 10:24936751-24936773 GGGTGGCTGCAGTTGTGGCCTGG - Intronic
1065806017 10:29394478-29394500 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1066101630 10:32122969-32122991 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1066101647 10:32123050-32123072 GGGTGGCTGCAGCAGCACCCAGG + Intergenic
1066508112 10:36066299-36066321 GGGTGGCTGGAGCTGTGCATGGG - Intergenic
1067017910 10:42771568-42771590 GGGTGGCTGCGGCTGCATCCAGG - Intergenic
1067087338 10:43249842-43249864 TGGTGGCTGCAGCAGCTTCCTGG - Intronic
1067258802 10:44667700-44667722 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1067431947 10:46251008-46251030 GGGAGGCTGCATCTGCAACCAGG - Intergenic
1067441469 10:46311194-46311216 GGGAGGCTGCATCTGCAACCAGG + Intronic
1067578173 10:47420643-47420665 GGGAGGCTGCATCTGCAACCAGG + Intergenic
1068060754 10:52064613-52064635 GGGTGGCTGCAGCCTTGCCCTGG + Intronic
1068120461 10:52778750-52778772 GGGGGCTTGCAGTTGCGCCCTGG - Intergenic
1068130495 10:52889822-52889844 GGGTGGCTGCAGCAGCACCAGGG - Intergenic
1068157803 10:53223362-53223384 GGGTGGCTACAGCTGTACACAGG + Intergenic
1068279996 10:54855281-54855303 GGGTATCTGCAGCTGCATCCAGG + Intronic
1068283779 10:54909645-54909667 GGGCAGCTGCAGCTGTGCCTAGG + Intronic
1068348342 10:55813237-55813259 GGGCTGCTGCAGCTGATCCCAGG - Intergenic
1068443795 10:57095032-57095054 GGGTGGCTGCAGCTACGTCTGGG - Intergenic
1068919150 10:62465008-62465030 GGGCAGCTGCATCTGCACCCGGG - Intronic
1068967188 10:62924513-62924535 AGGAGGCTGCAGCTGCACCTGGG + Intergenic
1068967209 10:62924607-62924629 GGGTGGCTGTGGCCCCGCCCAGG + Intergenic
1068967232 10:62924688-62924710 GGGCGGCCGCAGCAGCGCCTGGG + Intergenic
1069034189 10:63630423-63630445 GGGAGGCTGGAGCCGCGCCGGGG + Intergenic
1069121699 10:64576503-64576525 GGGCAGCTGCAGCTGCACCAGGG - Intergenic
1069212408 10:65779000-65779022 GGGCGGCTGCAGCTGTGTCCAGG - Intergenic
1069249216 10:66246384-66246406 GGCTGGCTGCAGCAGTACCCTGG + Intronic
1069561889 10:69436325-69436347 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1069592857 10:69652622-69652644 GGGCGACTGCAGCTGTGCCCAGG - Intergenic
1069871476 10:71535746-71535768 GGTGGGCTCCAGCTGTGCCCTGG - Intronic
1070121513 10:73582033-73582055 GGGTGGCTGCAGCTGGAGCCTGG - Intronic
1070201299 10:74208226-74208248 GGGTGGCTGCAGCTGCACTCAGG + Intronic
1070428674 10:76315328-76315350 GGGAAGCTGCAGCTGCACCAAGG - Intronic
1070610150 10:77927049-77927071 GGGTGGCGGCCGCGGGGCCCCGG - Intergenic
1070660674 10:78303327-78303349 GCGGCGCGGCAGCTGCGCCCCGG - Intergenic
1071052857 10:81473012-81473034 GAGTGGCTGCAGCTGTGCCTGGG - Intergenic
1071108516 10:82127138-82127160 GGGTGGCTGCAGGTGCTGCAAGG + Intronic
1071676440 10:87659956-87659978 GGCTGGCTGCGGCGGAGCCCGGG - Exonic
1072151618 10:92689505-92689527 GGGTGGCAGCAGCTGTTTCCAGG - Intergenic
1072154810 10:92714863-92714885 GGGCAGCTGCAGCTGCACTCTGG + Intergenic
1072470323 10:95707174-95707196 TGGGGGCTGCAGCTGCACCCGGG + Intergenic
1072753183 10:97999140-97999162 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1072753206 10:97999222-97999244 GGATAGCTGCAGCTGTGCCCAGG - Intronic
1072926292 10:99620223-99620245 GGGTGGCTGCAGCGGGGCGTGGG - Exonic
1072971400 10:100020862-100020884 GAGTGGCTGCAGCTGTGCCTGGG + Intergenic
1073260873 10:102189093-102189115 AAGTTGCTGCAGCTGCACCCAGG + Intergenic
1073446701 10:103585228-103585250 GAGTGCCCGCAGCTGCGCCTGGG + Intronic
1073930257 10:108566896-108566918 AGGTGGCTGCAGCTGCGCCTGGG - Intergenic
1074028643 10:109663215-109663237 GGGTAGCTGCAGCTGTGCGTGGG - Intergenic
1074028662 10:109663296-109663318 GGGCGGCTGCAGCTGCACCCAGG - Intergenic
1074028682 10:109663377-109663399 GGGCAGCTTCAGCTGCACCCGGG - Intergenic
1074301932 10:112240840-112240862 GGGCGGCAGCAGCGGTGCCCAGG + Intergenic
1075007611 10:118842140-118842162 GGGCGGCTGCAGCAACACCCAGG - Intergenic
1075007657 10:118842304-118842326 CGGTGGCTGCAGCTATGCCTGGG - Intergenic
1075007675 10:118842385-118842407 GGGCGGCTGCAGCTGCACCCGGG - Intergenic
1076292090 10:129353400-129353422 GGGGGGCTGCAGCTGCAGCCTGG + Intergenic
1076549252 10:131267427-131267449 GGGTGGCTGCAACTGAGCCTCGG + Intronic
1076655290 10:132019667-132019689 GGGTGGCTGCAGCTGAGCCTGGG + Intergenic
1076820084 10:132933895-132933917 CTGTGGCTGCTGCTGTGCCCAGG + Intronic
1076872663 10:133201344-133201366 GGGAGGCGGCAGCCGTGCCCGGG + Intronic
1076891044 10:133283595-133283617 GTGTGGGTGCAGCCCCGCCCTGG + Intronic
1077114495 11:877238-877260 GGGTGGGTGCAACTGCCCACGGG + Intronic
1077244055 11:1527399-1527421 GAGTGGCTGGAGCTGTGCGCTGG - Intergenic
1077479076 11:2804669-2804691 TGGTGGCTGCAGCTTCACGCTGG - Intronic
1077492826 11:2870023-2870045 GCGTGCGGGCAGCTGCGCCCAGG - Intergenic
1077844802 11:6013061-6013083 GGGTGGCTGCATCTGTGCCCAGG + Intergenic
1077881608 11:6354860-6354882 GAGGGGCCACAGCTGCGCCCAGG + Intergenic
1077912624 11:6586698-6586720 GAGTGGCTGCAGCTGTGCCCAGG - Intronic
1078345644 11:10545203-10545225 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1078459200 11:11500512-11500534 GGGTGGATGGAGATGCGCCATGG + Intronic
1078836515 11:15035360-15035382 GGGTGGCTGCGGCTTTGCCCAGG + Intronic
1078926856 11:15883008-15883030 AGGTGGCTGCAGCACTGCCCTGG + Intergenic
1079472443 11:20790753-20790775 GGGCGGCTGCAGCTATGCCTGGG + Intronic
1079673933 11:23202172-23202194 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1079733174 11:23961906-23961928 GGGTGGCTGTAGCCTCACCCAGG - Intergenic
1079733190 11:23961997-23962019 GGGTGGTTGCAGCTGAACCTAGG - Intergenic
1079996861 11:27304662-27304684 GGGTGGCTGCAGTTGCGCCTGGG - Intergenic
1080047172 11:27821293-27821315 AGCTGGCTGCAGCTGCCCCCGGG - Intergenic
1080320648 11:31005392-31005414 GGTTCACTGCAGCTGTGCCCTGG - Intronic
1080333835 11:31174144-31174166 GGGCGGCTGCAGTTGCACCTGGG - Intronic
1080584071 11:33665925-33665947 GGGTGGCTGCAGCTGCACCCAGG + Intronic
1080584121 11:33666136-33666158 GGGTGGCTGTAGCCCCACCCAGG + Intronic
1080584143 11:33666217-33666239 GGGTGGCTGCAGCAGCATCCAGG + Intronic
1080807010 11:35662925-35662947 GGGTCTTTGCTGCTGCGCCCGGG + Exonic
1080874890 11:36266222-36266244 GGCAAGCTCCAGCTGCGCCCAGG + Intergenic
1080967103 11:37225242-37225264 GGGTGGATGCACCTGCACCTGGG + Intergenic
1081044221 11:38251163-38251185 GGCTGGCTTCAGCTGTACCCGGG + Intergenic
1081164062 11:39786420-39786442 GGCTGGCCGCAGCTGCACCCTGG + Intergenic
1081237067 11:40659011-40659033 GGGTGGCTGCAGCTGTGCCAGGG - Intronic
1082260651 11:50074334-50074356 GGGAGGCTGCAGCTGGGTCTGGG + Intergenic
1082687812 11:56260874-56260896 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1082952330 11:58830847-58830869 GGGCGGCTGCAGGGGCACCCAGG - Intergenic
1083915958 11:65744025-65744047 GGGTGGCTGCGGCTGCACCAGGG - Intergenic
1083970094 11:66069703-66069725 GGTTGGCTCCAGATGGGCCCCGG + Intergenic
1084032084 11:66487073-66487095 GTGTTGCTGCAGCTCTGCCCAGG - Intronic
1084399582 11:68935948-68935970 GTGTGGCTGCAGCTGGCACCAGG - Intronic
1084469539 11:69348967-69348989 GGGTGGCTGCAGCTTCACCCAGG + Intronic
1084979662 11:72822379-72822401 GGGGGGCAGCAGCCGCCCCCTGG + Intronic
1085294183 11:75421379-75421401 GGGAGCCTGCAGCTGGGGCCTGG + Intronic
1085336653 11:75701880-75701902 AGGAGGCTGCAGCTGCCCTCTGG + Intergenic
1085403809 11:76249945-76249967 GGGTGGCTGTAGCTGTGCCCAGG - Intergenic
1085496757 11:76977766-76977788 GGGCATCTGCAGCTGTGCCCGGG - Intronic
1086085198 11:82946103-82946125 GGGTGGCTGCAGCTGCACCTGGG + Intronic
1086085220 11:82946193-82946215 GGGCAACTGCAGCTGCACCCTGG + Intronic
1086249188 11:84794472-84794494 GGGTGGCTGCAGCTGCACCCAGG - Intronic
1086249209 11:84794562-84794584 GGGTGGCTGCAGCTGCATCCTGG - Intronic
1086508394 11:87529119-87529141 GGGTGGCTTCAGCTGCACCTGGG + Intergenic
1087036129 11:93758351-93758373 GAGCTGCTGCAGCTGCGCCTGGG - Intronic
1087385110 11:97461282-97461304 GGGTGGCTGCAGCTGCGTCCAGG - Intergenic
1087534504 11:99425744-99425766 GGGTGGCTGCAACTGCACCCTGG + Intronic
1088650978 11:111958105-111958127 TGGTGACTGCAGCTGCGCCCAGG - Intronic
1088650999 11:111958196-111958218 GGGTGGCTGCAGCTGTGCCCGGG - Intronic
1088704353 11:112448150-112448172 AGGCAGCTGCAGCTGCACCCAGG + Intergenic
1089505875 11:118961561-118961583 GGGGGGCCGCAGCTGCACCCAGG + Intergenic
1089591774 11:119546458-119546480 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1089637957 11:119828488-119828510 GGGTGGCTGGAGATGTGCGCAGG + Intergenic
1089673006 11:120069390-120069412 GGATTGGTGCAGCTGCTCCCTGG - Intergenic
1089822647 11:121241878-121241900 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1090137112 11:124210029-124210051 GGATGGCTGCAGCTGCACCCAGG + Intergenic
1092046070 12:5432530-5432552 GGGTGGCTGCGGTTGCGCTTCGG - Intronic
1092272158 12:7031661-7031683 GGGTGGCTGTAGCTGCACCCAGG + Intronic
1092414792 12:8282121-8282143 GGGTGGCAGCAGCTGCTGCACGG + Intergenic
1092447193 12:8568338-8568360 GGGTGGCTGCAGAGGCATCCGGG + Intergenic
1092447226 12:8568461-8568483 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1092502885 12:9065285-9065307 AGGTGGCTGCAGCTGCACCCTGG - Intergenic
1092916587 12:13194833-13194855 GGGTGTCTGCAGGTGAGGCCAGG - Intergenic
1093493108 12:19726540-19726562 GGGTGGCTGCAGCCATGCCTGGG + Intergenic
1094107876 12:26832976-26832998 GGGTGTCCGCAGCTGCGGCTTGG - Exonic
1094427232 12:30328161-30328183 GAGCAGCTGCAGCTGCACCCAGG - Intergenic
1095444195 12:42268034-42268056 GAGTGGCTGCAGCTGCGCCCAGG + Intronic
1095603091 12:44037136-44037158 GGGTGGCTGCAGCTTCACCTGGG - Intronic
1095749797 12:45697393-45697415 GGGTAGCTGCAGCTGCACTTGGG + Intergenic
1096355648 12:50938478-50938500 GGCCAGCTGCAGCTGTGCCCAGG + Intergenic
1096495564 12:52037458-52037480 GGGTGGCGGGAGGTGGGCCCCGG + Intronic
1096576478 12:52556148-52556170 GGGTGGCTGCAGCAGCGGCAGGG - Intergenic
1097076382 12:56397649-56397671 GGGTGGCTGCAGCAGCACCCAGG + Intergenic
1097078255 12:56410783-56410805 GGGTAGCTGCAGCGGCACCCGGG + Intergenic
1097078272 12:56410876-56410898 GGGTGGCTGTAGCCCAGCCCAGG + Intergenic
1097130058 12:56805115-56805137 GGGTGTCTGCAGCTGCATCCAGG + Intergenic
1097130075 12:56805191-56805213 GGGTGGCTGCAGCCACGCCTAGG + Intergenic
1097130990 12:56810564-56810586 GGGTGGTTGCAGCTGTGCCTAGG + Intergenic
1097131023 12:56810714-56810736 GGGTGGCTGTGGCTGCATCCAGG + Intergenic
1097299136 12:57998768-57998790 GGGTGGCTGCAGCAGCACCTGGG + Intergenic
1097316957 12:58181717-58181739 AGGTGCCTGAAGCTGAGCCCAGG + Intergenic
1097446589 12:59679142-59679164 GGGTGGTTGCAGCTGCACCCAGG + Intronic
1097492086 12:60282910-60282932 GGGTGGCTGCAGCTATGCTCAGG + Intergenic
1097492107 12:60283008-60283030 GGGTGGCTGCAGGTACACCCAGG + Intergenic
1097684129 12:62676444-62676466 GGGTGGCTGCACCTGCACCCAGG - Intronic
1098290956 12:68956348-68956370 GGGCAGCTGCAGCTGCACCCAGG + Intronic
1098671532 12:73235832-73235854 GGGTGGCTGTAGCTGTGCCTGGG + Intergenic
1098790472 12:74816490-74816512 GGGTGGCTGCTTCTGTGCCCAGG - Intergenic
1099561070 12:84174309-84174331 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1099574438 12:84362304-84362326 GGGTGGCTACAGCTGTGCCCAGG - Intergenic
1099682198 12:85843809-85843831 GGGTGGCTTCAGCTGTGCCCAGG - Intergenic
1099683446 12:85857101-85857123 GGGTGGCTGTTGCTGCATCCTGG + Intergenic
1099713747 12:86264573-86264595 GGGTGGCTGCAGCTTCACCTGGG - Intronic
1100847768 12:98678516-98678538 GGGCGGCTACAGCTACACCCAGG - Intronic
1101409565 12:104457345-104457367 GGGTCCCTGCTCCTGCGCCCCGG + Exonic
1101764097 12:107682611-107682633 GGGCGGCTGCAGCTGCACCTGGG + Intergenic
1101764126 12:107682760-107682782 GGGTGACTGCAGCAGTACCCCGG + Intergenic
1102060297 12:109926412-109926434 CAGTGGCTGCAGCTGTACCCAGG - Intronic
1103173560 12:118843274-118843296 GGGAGACTGCAGCTGCGTCCAGG - Intergenic
1103323055 12:120102719-120102741 GGCTGGCTGCCCCTGCCCCCGGG - Intronic
1103785167 12:123427205-123427227 GGCTGTCAGCAGGTGCGCCCTGG + Intronic
1104058075 12:125245575-125245597 GAGGGGCAGCAGCTGCTCCCCGG + Intronic
1104568215 12:129903709-129903731 CGGCGGCTCCAGCTGCTCCCGGG + Intergenic
1104739778 12:131164136-131164158 AGATGGCTGCAGCTGCTTCCTGG + Intergenic
1104742412 12:131188355-131188377 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1104805450 12:131586608-131586630 GGACAGCTGCAGCTGCACCCAGG - Intergenic
1104948593 12:132428566-132428588 GGGTGGCTGGAGCTGGGCGTGGG - Intergenic
1105225077 13:18424569-18424591 GGGTGGCAGCAGCTGCCCGAGGG - Intergenic
1105270917 13:18875022-18875044 GTGGGGCTGCAGCTGCGGGCGGG + Intergenic
1105954601 13:25268813-25268835 GGGCGGCTGCAGCTGTGCCCGGG - Intronic
1106308760 13:28534989-28535011 GGGCGGCTGCAGCCCAGCCCAGG - Intergenic
1106379433 13:29222688-29222710 GGGCAGCTGCAGCTGCACCCAGG - Intronic
1106571886 13:30934815-30934837 GGGTGGCTGTAGCCTCGCCCAGG - Intronic
1106571923 13:30934988-30935010 GGGCAGCTGCAGCTGCACCAGGG - Intronic
1106979230 13:35256911-35256933 GGGCAGCTGCAGTTGCACCCGGG + Intronic
1107228942 13:38085865-38085887 GGGTAGCTGCAGTTGCACCCAGG - Intergenic
1107513457 13:41107382-41107404 GGGCGGCTGCAGCCCTGCCCAGG - Intergenic
1107699933 13:43036992-43037014 GGGCGGCTGCAGCTGCTCCTGGG + Intronic
1107841023 13:44458577-44458599 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1107853316 13:44591621-44591643 GGGAGGCTGTAGCCCCGCCCAGG - Intergenic
1107875973 13:44790445-44790467 GGGTGGCTGTAGCTGGGCCCAGG + Intergenic
1108017104 13:46087069-46087091 GGGCAGCTGCAGCTGCGCCCAGG + Intronic
1108017126 13:46087158-46087180 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1108118694 13:47160161-47160183 GGGTGGCTTCAGCTGCACCTGGG - Intergenic
1108240439 13:48457963-48457985 GGGTAGCTGCAGCTGCACTGGGG + Intronic
1108249493 13:48550761-48550783 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1108542559 13:51457161-51457183 GGGTGGCTGCAGCTGCACTCAGG + Intergenic
1108559526 13:51628494-51628516 GGATGGCTGCAGCTACACCCAGG + Intronic
1108854525 13:54775933-54775955 GGGTGGCTGCAACTGTGACTGGG + Intergenic
1109030103 13:57179888-57179910 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1109030123 13:57179980-57180002 GGGTGGCTGCAGTCCTGCCCAGG + Intergenic
1109345771 13:61113392-61113414 GGGTGGCTGCAGCTGTTCCTGGG - Intergenic
1109348367 13:61145078-61145100 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1109396624 13:61766783-61766805 GGACGGCTGCAGCTGCGCCCAGG + Intergenic
1109470545 13:62799055-62799077 GGGAGGCTGAAGCTGGACCCAGG - Intergenic
1109563405 13:64078847-64078869 GGGCGGCCGCAGCTTTGCCCGGG + Intergenic
1109633798 13:65086232-65086254 GGATAGCTGCAACTGTGCCCAGG + Intergenic
1109686558 13:65829406-65829428 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1109687685 13:65843369-65843391 GGGAAGCTGCAGCTGTGCCTGGG - Intergenic
1109762311 13:66845527-66845549 GGGTGGCTATAGCTGCGACTGGG + Intronic
1109780619 13:67106668-67106690 GGGTGGCTGCAGCTGTGCCCAGG - Intronic
1109837334 13:67877278-67877300 GGGTGGCTGCACCTGTGCCAGGG - Intergenic
1109837359 13:67877368-67877390 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
1109982194 13:69923836-69923858 GGGCAGCTGCAGCTGCGCCTGGG - Intronic
1110014825 13:70387073-70387095 CGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1110201038 13:72851212-72851234 GGGCCACTGCAGCTGCGCCTGGG - Intronic
1110342829 13:74413436-74413458 GGGTAGCTGCAGCAGTGCCTCGG - Intergenic
1111000018 13:82165924-82165946 GGGTGGCTGTAGCCCCGCCCAGG + Intergenic
1111002553 13:82205083-82205105 GGGTGGCTACAGCTGTGCCCAGG - Intergenic
1111091382 13:83452420-83452442 GGGCGGGTGCAGCTGTTCCCAGG - Intergenic
1111202947 13:84962523-84962545 GGGTGGCTGCAGCTACACCCAGG + Intergenic
1111237701 13:85430975-85430997 GGGTGGCTGCAACTGAACCTGGG - Intergenic
1111253690 13:85639151-85639173 GGTTGGCTGCAGCTGCTCCTGGG + Intergenic
1111268716 13:85853317-85853339 GGGCTGCTGCAGCTGCACCTGGG - Intergenic
1111337348 13:86840672-86840694 GGGTGGCTACAGCTGCACCCAGG + Intergenic
1111347198 13:86974480-86974502 GGGTGGCTGCAGCTGTGACTGGG - Intergenic
1111487884 13:88927286-88927308 GGGGGACTGCAGCTGTGCCCAGG + Intergenic
1111512787 13:89287797-89287819 GGGTGGCTGCAGCCCCACCTGGG + Intergenic
1111512808 13:89287878-89287900 GGGTGGCTGCAGCAGCAGCCAGG + Intergenic
1111546272 13:89741193-89741215 GGGTGGCTGCAGCCACACCTGGG - Intergenic
1111549205 13:89784644-89784666 GGTTGGCTGTGGCTGTGCCCAGG + Intergenic
1112086006 13:96033517-96033539 GGGTGGTTGCAGCTGCACCCAGG - Intronic
1112159602 13:96853784-96853806 GGATGGCTTCAGGTGTGCCCTGG - Intergenic
1112911026 13:104483818-104483840 CGGTGGCTGCAGCTGCGCCCAGG + Intergenic
1113339044 13:109404392-109404414 GGGTGGCTGCAACAGCACCCAGG - Intergenic
1113513632 13:110874515-110874537 CCCTGGCTGCAGCTGTGCCCGGG + Intergenic
1113804570 13:113105894-113105916 GCCTGGCTGCAGGTGCGTCCGGG + Exonic
1113928609 13:113954541-113954563 CGGTGGACGCAGCTGAGCCCCGG - Intergenic
1113940082 13:114014467-114014489 GGGTGTCTGCAGCTGTCCCGAGG + Intronic
1113970574 13:114185501-114185523 AGGTGGCTGCAGCTGTACCCAGG - Intergenic
1114280916 14:21192072-21192094 GGGTAGCCGCAGCGGCGCCCAGG - Intergenic
1114280956 14:21192244-21192266 TGGTGGCTGCAGCTGTGCCCTGG - Intergenic
1114280978 14:21192337-21192359 GGGTGGCGGCAGCTGCGTGTGGG - Intergenic
1114344427 14:21780699-21780721 GGGCAGCTGCAGTTGCACCCAGG - Intergenic
1115059018 14:29168363-29168385 GGGAGGCTGCCGCTGCATCCGGG - Intergenic
1115310689 14:31975118-31975140 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
1116167167 14:41349415-41349437 GGCTGGCTGCAGCTGTGCCTGGG - Intergenic
1116356650 14:43938787-43938809 GGGCAGCTGCAGCTGTGCCGGGG - Intergenic
1116448641 14:45039787-45039809 GAGTGGCTGCAGCTGCACCCAGG + Intronic
1116617166 14:47154442-47154464 GGGTGGCTGCAGCTGTGCCTGGG - Intronic
1116790086 14:49330379-49330401 GGGTGGCTGCAGCTGCCCCCAGG + Intergenic
1116821939 14:49634798-49634820 GGCTGCCAGGAGCTGCGCCCCGG + Exonic
1116948343 14:50856788-50856810 GGGTGGCAGCAGCTCCTCTCAGG - Intergenic
1116961539 14:50973012-50973034 GGGCTGCCGCAGCTGCGCCTGGG - Intergenic
1117285584 14:54283001-54283023 GGGTGGCAGCAGCTGCACCCAGG + Intergenic
1117733886 14:58750773-58750795 GGATGGCCGCAGCTGCTCCCAGG - Intergenic
1118200191 14:63664045-63664067 GGGCGGCTGCAGGTGCATCCAGG + Intergenic
1118213679 14:63788423-63788445 AGGCAGCTGCAGCTGCACCCGGG + Intergenic
1118213723 14:63788601-63788623 GGACGGCTGCAGCGGCACCCAGG + Intergenic
1118473216 14:66094118-66094140 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
1118522251 14:66597646-66597668 GGGTGGCTGCAGCTGCACCCAGG + Intronic
1118722618 14:68605025-68605047 GGGAGGCTGCAGCACCGCCTGGG - Intronic
1119364094 14:74077010-74077032 GGGTGCCTGCAGCACTGCCCAGG + Intronic
1119520072 14:75278701-75278723 GGGCGGCCGCAGAAGCGCCCAGG + Intergenic
1119547463 14:75482657-75482679 TGGTGGCTTCAGCTGCACCTGGG + Intergenic
1119618092 14:76111923-76111945 GGGTGGCCACAGCTGGGCCCTGG - Intergenic
1120251141 14:82062945-82062967 GGGTGGCAGCAGCTGCTGCACGG + Intergenic
1120745425 14:88147177-88147199 GGGCAGCTGCAGCTACACCCAGG - Intergenic
1120993285 14:90397173-90397195 GGGTGGCTGCACCAGCGCGGGGG - Exonic
1121224533 14:92311536-92311558 GGGGGTCTGGAGCTGCTCCCAGG - Intergenic
1121259502 14:92555890-92555912 GTGTGGCTGCAGCTGAGTCTGGG + Exonic
1121973923 14:98385340-98385362 GGGTGGCTGCAACTGCACCCAGG - Intergenic
1121973960 14:98385504-98385526 GGGCAGTTGCAGCTGCACCCAGG - Intergenic
1122126106 14:99579580-99579602 GGCTGTCTGGGGCTGCGCCCTGG - Intronic
1122449176 14:101790425-101790447 GGGTGCCTGCAGCTGGGGCCCGG - Intronic
1122776027 14:104117269-104117291 GGGTGGCTGCAGCAGGGCAGGGG + Intergenic
1122830307 14:104392675-104392697 TGGGGGCTGCAGATGGGCCCCGG + Intergenic
1122996649 14:105268793-105268815 TGGTGGGTGCTGTTGCGCCCTGG + Intronic
1123014022 14:105365061-105365083 GGGTGGAGGGAGCTGGGCCCTGG + Intronic
1123222907 14:106873085-106873107 GGGAGGCTGCATCTGAGCCCAGG - Intergenic
1202840143 14_GL000009v2_random:114152-114174 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1202909527 14_GL000194v1_random:104349-104371 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1202883751 14_KI270722v1_random:84927-84949 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1202940704 14_KI270725v1_random:143187-143209 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1123392380 15:19889540-19889562 GGGTGGCAGCAGCTGCCCAAGGG - Intergenic
1123893358 15:24803259-24803281 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
1124414930 15:29466722-29466744 GGGTGGATGCTGCAGCCCCCAGG + Intronic
1124820743 15:33043888-33043910 GGGCAGCTGCAGCTGCACCCAGG - Intronic
1124937455 15:34186465-34186487 AGGTGGCTGCAGCTGCACCCTGG - Intronic
1125381714 15:39092956-39092978 GGGTGGCTATAGCTGTACCCAGG + Intergenic
1125435932 15:39645539-39645561 CCGTGGCTCCAGCTGCACCCAGG - Intronic
1125505321 15:40264716-40264738 GGGTGGCTGCAGCAGGGCCTGGG - Intronic
1125717982 15:41830519-41830541 GGGTGGCTGTAATTGCGCCTAGG - Intronic
1125718002 15:41830609-41830631 GGGAGGCTGCAGCTGCATCTAGG - Intronic
1125861983 15:43008262-43008284 GGGCAGTTGCAGCTGTGCCCGGG - Intronic
1126185827 15:45829680-45829702 GGGTGGGCGCAGCTGCACCCGGG + Intergenic
1126292761 15:47100060-47100082 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1126549260 15:49908982-49909004 GGGTGGCAGTAGCTGCACTCTGG - Intronic
1127017870 15:54708584-54708606 GGGCGGTTGCAGCTACACCCAGG + Intergenic
1127526038 15:59792551-59792573 GCGCCGCTGCAGCTGTGCCCGGG + Intergenic
1127795880 15:62437996-62438018 TGGTGGCAGCAGATGCACCCTGG + Intronic
1128078223 15:64841584-64841606 GGGTGGCGGGAGCGGCGCGCAGG - Intergenic
1128149773 15:65355604-65355626 AAGTGGCCGCAGCTGCGCCCCGG + Intronic
1128790782 15:70432054-70432076 GGGTGGCCGCAGCTGCACCCAGG + Intergenic
1128847742 15:70916756-70916778 GAGTGGCTGCAGCAGCACCCGGG - Intronic
1128847765 15:70916847-70916869 GGGAGGCTGCAGCTGTACCCAGG - Intronic
1128965141 15:72051378-72051400 AGGTGGCCGCAGCTGCACCTAGG - Intronic
1128965166 15:72051471-72051493 GGGCGGCTGCAGCTGTGCCTGGG - Intronic
1129178619 15:73857479-73857501 GGCTGCCTGCAGCTGAGCTCAGG - Intergenic
1129183444 15:73891535-73891557 GGGTGGCTGCAGCTGTGCCAGGG - Intergenic
1129265091 15:74389051-74389073 GCGAGGCTGCAGCTGAGCCCAGG + Intergenic
1129369106 15:75076857-75076879 GGATGGCTGCAGCCGTGCCCAGG + Intronic
1129377830 15:75145335-75145357 GAGTGGCTGCAGCTGCTCCTTGG + Intergenic
1129377855 15:75145427-75145449 GGGTGGCCACAGCCACGCCCAGG + Intergenic
1129784918 15:78303844-78303866 GGGCGGCTGCAGCAGCACCTGGG - Intergenic
1129799870 15:78405799-78405821 GGGCGGCTGCAGCTGCACCCAGG - Intergenic
1129928302 15:79385494-79385516 AGGTGGCTGCAGCTGCACCTGGG + Intronic
1130183056 15:81651303-81651325 GGGTGGCTGCAGCTGTGACTGGG - Intergenic
1130733390 15:86522860-86522882 GGTTGGCTGCAGATGAGCACTGG - Exonic
1132305220 15:100807310-100807332 GGGTGGCTGCGGCTGCACCTGGG - Intergenic
1132628210 16:902432-902454 GGCTTCCTGCAGCTGCGCCCTGG + Intronic
1132837066 16:1959503-1959525 GGGCGGCTGCGTCTGCGCGCTGG - Exonic
1132897924 16:2237672-2237694 GGGTCCCTGCAGGCGCGCCCCGG + Intronic
1132978909 16:2724912-2724934 GGGTGGCTGCTGATGTGCCTGGG - Intergenic
1133022879 16:2974576-2974598 GGCTGGCAGCAGCTGCGCCAGGG - Exonic
1133059209 16:3163573-3163595 GCGAGGCTGCTGCTGGGCCCTGG + Intergenic
1134015125 16:10882924-10882946 GGGAGTCTGCAGCCGGGCCCAGG - Intronic
1134078533 16:11308994-11309016 GGGTGGCTGCAGCTGTACCCAGG + Intronic
1134254469 16:12600336-12600358 GGGTGGCTGCAGTTGTGCCCAGG - Intergenic
1135057256 16:19241407-19241429 AGGTGGCTGCAGCTGCACCCAGG + Intronic
1136630856 16:31488554-31488576 GGGCGGCTGCAGCTGCGCGAGGG - Intronic
1136872932 16:33824768-33824790 GGGTGGCTGCAGCCACGCCCGGG + Intergenic
1137037427 16:35578438-35578460 GGGTGCCTGCAGCTGCCTCCAGG + Intergenic
1137238396 16:46633875-46633897 GGGTGGCTGTTGCCCCGCCCAGG + Intergenic
1137256236 16:46777874-46777896 GGCTGGCTGCAGTTGCACCCGGG - Intronic
1137282790 16:46992524-46992546 CGGTGGCCGCAGCTACACCCTGG + Intergenic
1137282844 16:46992738-46992760 GGGTGGCTGTAGCCCCACCCAGG + Intergenic
1137291602 16:47055463-47055485 GGGTGGCCGCAGCTGCATCCAGG + Intergenic
1137291675 16:47055759-47055781 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1137334451 16:47533874-47533896 GGGCAGCTGCAGCTGCACCAGGG + Intronic
1137334472 16:47533955-47533977 GGGCGGCTGCAGCTGCACCCAGG + Intronic
1137588522 16:49679349-49679371 AGGTGGCTGCAGCTGTGCTGGGG - Intronic
1137617704 16:49856959-49856981 CGGCGGCGGCGGCTGCGCCCCGG + Intronic
1137788390 16:51154780-51154802 GTGAGGCGGCAGCTGCGCCGGGG + Intergenic
1138077577 16:54057817-54057839 TGGTGGACGCAGCTGGGCCCAGG - Intronic
1138093564 16:54195069-54195091 GGGTGTCTCCAGCTGAGCTCTGG - Intergenic
1138394726 16:56695344-56695366 GGGTGGTTGCAGCCCCACCCAGG - Intronic
1138878236 16:60979211-60979233 GGGCAGCTGCAGCTGCACCTTGG - Intergenic
1139015393 16:62683907-62683929 GGATGACTGCAGCTGCGCCTGGG - Intergenic
1139088798 16:63618634-63618656 GGGCGCCTGCAGCTGTGCCTGGG + Intergenic
1139150862 16:64380952-64380974 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1139182999 16:64770164-64770186 GGGAGGCTGCAGCTGTGGCCAGG - Intergenic
1139183020 16:64770254-64770276 GGGTGGCTGCAGCTGCACTCAGG - Intergenic
1139390109 16:66601925-66601947 GGGTAGCTGCAGCTGCACCTGGG + Intergenic
1139463739 16:67142736-67142758 GGGAGGCTGCAGCTACACCCAGG + Intronic
1139625935 16:68188287-68188309 GAGTGGCTGTAGCTGCACCCAGG + Intronic
1139625962 16:68188387-68188409 GGGTGGCCACAACTGCACCCAGG + Intronic
1139697626 16:68686265-68686287 GGGTGAGTGCACCTGCACCCAGG + Intronic
1139923400 16:70473162-70473184 GCACGGCTGCAGCTGCTCCCAGG - Exonic
1140103386 16:71938073-71938095 GGGCAGCTGCAGCTCTGCCCAGG - Intronic
1141691491 16:85599345-85599367 GGGTGTCTGCCGCTCAGCCCTGG - Intergenic
1141995817 16:87635824-87635846 AGGTGGCTGCAGCAGAGCCGGGG + Intronic
1142067050 16:88068663-88068685 GGGTGGCTGCGGATCCACCCAGG + Intronic
1142348178 16:89567449-89567471 CCCTGGCAGCAGCTGCGCCCGGG + Intergenic
1203099238 16_KI270728v1_random:1291286-1291308 GGGTGGCTGCAGCCACGCCCGGG - Intergenic
1142586680 17:978946-978968 GGGTGGGGGCGGCTGCGCTCGGG - Intronic
1142940788 17:3378516-3378538 GGGCAGCTGCAGCTGCGCCTAGG + Intergenic
1143360450 17:6365017-6365039 GGTGGGCTGCAGCTGGGCCTTGG - Intergenic
1143466882 17:7143103-7143125 GGGTGGCTACAGCAATGCCCTGG + Intergenic
1143830343 17:9645806-9645828 GGGGGGCTTCGCCTGCGCCCCGG + Exonic
1143851623 17:9817208-9817230 GGGTGGGAGCAGCTGCAACCTGG - Intronic
1144061003 17:11583345-11583367 GGGTGGCTACAGCTGCATCCCGG + Intergenic
1144389877 17:14783947-14783969 GAGTGGCTGCAGCTGTGCCCAGG - Intergenic
1144394334 17:14828930-14828952 GGCTGGCTTCAGCACCGCCCTGG + Intergenic
1144586727 17:16491878-16491900 GCGTCGCTGCTGCTGCGCGCCGG - Exonic
1144733422 17:17541542-17541564 GGCTCGCTGGAGCTGGGCCCAGG - Intronic
1144873195 17:18382889-18382911 GGGTGGCTGCAGGTGGGCCTGGG + Intronic
1145007268 17:19344752-19344774 GGGCGGCTGCAGAGGGGCCCAGG + Intronic
1145217187 17:21061249-21061271 GGGCAGCTGCAGCTGCCCCCAGG + Intergenic
1145368504 17:22286753-22286775 GGGCAGCTGCAGTTGCGCCTGGG - Intergenic
1145902738 17:28498810-28498832 GGGTGGCTCCAGCCCCACCCTGG + Intronic
1145960583 17:28884487-28884509 GGGTGGGTGCAGGTGGCCCCAGG + Intronic
1146093433 17:29905450-29905472 GGGTGGCTGCAGCCTCACCCAGG - Intronic
1146359057 17:32159466-32159488 GGGCAGCTGCAGCTGCGACTGGG - Intronic
1146425176 17:32731750-32731772 GGGCGGCCACAGCTGCACCCAGG - Intronic
1146459317 17:33033257-33033279 GGGCGGCTGTAGCCCCGCCCAGG - Intronic
1146761417 17:35482455-35482477 GGGTGGCTGCAGCAGCACCTGGG - Intronic
1148071941 17:44913805-44913827 GGGTGGCTTCATCTGCTTCCTGG + Exonic
1148386404 17:47237939-47237961 GGGTGGCTGCAGCAGCACCTGGG + Intergenic
1148690469 17:49524194-49524216 CGGTGGCTGCATCTTTGCCCTGG - Intergenic
1150520922 17:65866066-65866088 GGGTGGCTGCAGTTGCACCCAGG - Intronic
1150950784 17:69800993-69801015 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
1150950814 17:69801084-69801106 GGGCAACTGCAGCTGTGCCCAGG - Intergenic
1150952679 17:69821230-69821252 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
1151395432 17:73819812-73819834 GTGTGACTGCAGCTGTGCTCAGG + Intergenic
1151428324 17:74045766-74045788 GGGTGGCTGCCTCGGCGCCTGGG - Intergenic
1151719246 17:75846222-75846244 CGGGGGCTGCAGCTGGACCCTGG + Exonic
1151972417 17:77465653-77465675 GGGGGCCTGCAGCTGGGTCCTGG + Intronic
1152139738 17:78529440-78529462 GGGTGGGTGTGGCTGCGTCCAGG - Intronic
1152196408 17:78920913-78920935 GAGTGGCTGCCTCTGCCCCCGGG - Intronic
1152319369 17:79599575-79599597 GGGGGGCTGCGGCTCCGCCATGG - Intergenic
1152530205 17:80914278-80914300 GGGTGGCTGTAGCTGCACCTGGG - Intronic
1152530229 17:80914368-80914390 GGGTGGCTGCAGCTGTGCCTGGG - Intronic
1152530252 17:80914456-80914478 GGGTGGCTGCAGCTGCACCTGGG - Intronic
1152680423 17:81665142-81665164 AGGAGGCTGCGGCTGCGTCCTGG + Exonic
1152720578 17:81922032-81922054 GGGGGCGTGCAGCTGGGCCCAGG - Exonic
1152864273 17:82712929-82712951 GGGAAGCTGCACCTGCACCCAGG + Intergenic
1152992195 18:373705-373727 GGGGGGCTGCTGCTTCTCCCAGG - Intronic
1153139485 18:1954958-1954980 GGGCGGCTGTATCTGCACCCAGG + Intergenic
1153608051 18:6854732-6854754 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1153608096 18:6854915-6854937 GGGGGGTTGCAACAGCGCCCGGG - Intronic
1153723875 18:7936262-7936284 GGGTAGCTGCAGCTGCACCTGGG - Intronic
1154346709 18:13548703-13548725 GGGGGGCTGCAGCTATGCCTGGG + Intronic
1154357638 18:13633809-13633831 TTGTGACTGCAGCTGCACCCAGG + Intronic
1154507861 18:15060575-15060597 GGGCAGCTGCAGCAGCACCCGGG - Intergenic
1154507881 18:15060656-15060678 GGGCAGCTGCAGCTGCACCCGGG - Intergenic
1154528290 18:15314953-15314975 GGGTGGCAGCAGCTGCCCGAGGG + Intergenic
1154954354 18:21241178-21241200 GGGAGGCAGCCGCGGCGCCCAGG - Intergenic
1155120801 18:22816767-22816789 TGGCTGCTGCAGCTGCACCCAGG + Intronic
1155169975 18:23260068-23260090 AGGTTGCTGCAGCTGCCCCCAGG + Exonic
1155819077 18:30352519-30352541 GGTCAGCTACAGCTGCGCCCAGG - Intergenic
1155830951 18:30514145-30514167 GGGCAGCTGCAGCTGCACACAGG + Intergenic
1155830965 18:30514226-30514248 GGGTAGGTGCAGCTGCACCCAGG + Intergenic
1156147576 18:34204034-34204056 GGGTGGCTTCAGGTGAGGCCAGG - Intronic
1156160236 18:34350710-34350732 GGGTGGCTGCAACTGCACCCTGG - Intergenic
1156179991 18:34592066-34592088 GTGTGGCTGCAGCTGCTCCTTGG - Intronic
1156244531 18:35284741-35284763 GGGTGGCTACAGCTGCACAAAGG + Intronic
1156244556 18:35284869-35284891 GGGTGGCTGCAGTTGCACCCAGG + Intronic
1156298912 18:35818199-35818221 GGGAGGCTGCAGCTGCACCCAGG + Intergenic
1156298943 18:35818321-35818343 GAATGGCTGCAGTTGCACCCAGG + Intergenic
1156298968 18:35818414-35818436 GGATGGCTGCAGCGGCACCCGGG + Intergenic
1158139583 18:54242221-54242243 TTGTGGCTGCAGCTGTGCCTGGG + Intergenic
1158773730 18:60552830-60552852 CCATGGCTGCAGCTGCACCCAGG - Intergenic
1158774019 18:60555272-60555294 GGGTGACTGCAGCTGCACCCAGG - Intergenic
1158962305 18:62596894-62596916 GCGCGGCTCCAGCGGCGCCCGGG - Intergenic
1159186574 18:64983600-64983622 GGGCGGCTGCAGCGGCACCTTGG - Intergenic
1159186609 18:64983747-64983769 GGGCAGCTGCAGCTGCGCCCAGG - Intergenic
1159292336 18:66439505-66439527 GGGAGGCTGTAGCTGAGCCTGGG - Intergenic
1159519168 18:69496042-69496064 GTATGGCTGTAGCTGCACCCAGG + Intronic
1159623743 18:70669063-70669085 GGGCAGCTGCAGATGCACCCAGG - Intergenic
1159704978 18:71675141-71675163 AAGTGGCTGCAGCTGCACCTGGG + Intergenic
1159774378 18:72586058-72586080 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
1159940141 18:74400573-74400595 AGGTTGCTGCACCTGGGCCCGGG - Intergenic
1160083677 18:75754250-75754272 GGGTGACTGCAGCTGCACCCAGG + Intergenic
1160116738 18:76085454-76085476 GGGTGGCTGCAGTTGTGCCTGGG + Intergenic
1160135230 18:76265998-76266020 GGCTGACTGAAGCTGGGCCCTGG - Intergenic
1160425742 18:78778048-78778070 CGGCGGCTGGAGCTGCTCCCCGG + Intergenic
1160531703 18:79568980-79569002 GCATGGCTGCAGCTGCTGCCAGG - Intergenic
1160806701 19:995142-995164 GGGCGGCTCCAGCTGGGCCCTGG - Intronic
1160870110 19:1274119-1274141 AGCTGGCTCCAGCTGCGCCAAGG + Intronic
1160916146 19:1497569-1497591 GGGTGGCTGCAGGGGCCCCGAGG - Exonic
1161069702 19:2253916-2253938 GGCTGGGTTCACCTGCGCCCGGG - Intronic
1161253892 19:3295669-3295691 TGGAGGCTGCAGCTGGGACCAGG - Intronic
1161470415 19:4454238-4454260 TGGTGGCTGCAGGTGGCCCCTGG - Intronic
1161583673 19:5093882-5093904 GGGACGCTGCAGCTGCGGCCTGG + Intronic
1161741436 19:6023241-6023263 GTGTGGGAGCAGCTGGGCCCTGG - Intronic
1161781697 19:6297449-6297471 GGGTGGCTGCAGCTGCATTGGGG - Intergenic
1162156875 19:8684370-8684392 GGGAGGCTGGGGCTGCTCCCAGG - Intergenic
1162782478 19:13013473-13013495 AGCCCGCTGCAGCTGCGCCCGGG + Intronic
1162932459 19:13963773-13963795 GGGTGACGGCGGCTGAGCCCCGG - Intronic
1162975777 19:14206485-14206507 GGGGGCCTGCAGGGGCGCCCCGG - Intergenic
1163023575 19:14496373-14496395 GGGGAGCTGCAGCTGGGCCCCGG + Intergenic
1163138527 19:15331588-15331610 AGGTGGCTGCGGCTGCACGCCGG - Intronic
1163403319 19:17107657-17107679 TGGTGGCTGCAGATGTGCCCTGG + Intronic
1164984340 19:32637669-32637691 GGGCGGCTGCAGCTGCGCCTGGG - Intronic
1165022445 19:32935778-32935800 GGGCAGCTGCAGCAGCACCCAGG - Intronic
1165745980 19:38229618-38229640 GCGCGGCGGCAGCGGCGCCCCGG - Intronic
1166267669 19:41695210-41695232 GGGTGGATGCAGCCGGGCCAGGG - Intronic
1166897304 19:46032217-46032239 GGGTGGCTGCAGCTGCACCCGGG - Intergenic
1166897346 19:46032378-46032400 GGGCAGCTACAGCTGTGCCCAGG - Intergenic
1166897367 19:46032456-46032478 GGGTGGCTGCAGCTATGCCTGGG - Intergenic
1166959972 19:46491500-46491522 GAGTGCCTGCAGCTGTGGCCTGG + Exonic
1167013051 19:46821663-46821685 GGGCAGCTGCAGCTGCACCCGGG - Intergenic
1167072939 19:47231080-47231102 CTGTGGCTGCTGCTGCTCCCCGG + Intronic
1167234931 19:48308688-48308710 TGGTGGCTGCAGCTGCACACGGG - Intronic
1167234967 19:48308861-48308883 GGGCAGCTGCAGCTGCACCCGGG - Intronic
1167235002 19:48308984-48309006 GGGTGGCTGCAGCTGCACTCTGG - Intronic
1167346125 19:48946737-48946759 TGGGGGCTGCAGCTGTGCCTTGG - Intergenic
1167605780 19:50480726-50480748 GGGCGGCTGCAGCTGCACCGAGG - Exonic
1168303309 19:55419425-55419447 TGGTGGCTGCAGCTGCACCCAGG - Intergenic
1168613545 19:57819911-57819933 CGATGGCTGCGGCTGCGCCGAGG + Exonic
1168630325 19:57950928-57950950 AGGTGGCTGCAGCTGCGCCTGGG + Intergenic
1202632898 1_KI270706v1_random:16406-16428 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1202652976 1_KI270707v1_random:23644-23666 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1202659174 1_KI270708v1_random:52101-52123 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
924963778 2:57560-57582 GGGTGGCTGCAGCTTCACCCAGG - Intergenic
925381389 2:3429002-3429024 GGATGGATGAAGCTGGGCCCTGG - Intronic
925515180 2:4674200-4674222 TGGCAGCTGCAGCTGCACCCAGG - Intergenic
925609467 2:5691863-5691885 GGGTGGGCGCAGCTGCTCCCCGG - Intergenic
925922591 2:8647328-8647350 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
926006843 2:9379081-9379103 GGGTGGGCTCAGCTGCACCCTGG + Intronic
926070505 2:9884792-9884814 GGGTGGCTGCAGCAGCACCCAGG - Intronic
926145885 2:10396978-10397000 GGGTGGCTCCTGCTGTGCCGTGG + Intronic
926547118 2:14255561-14255583 GGGTGAGTGCAGCTGTGCCCAGG + Intergenic
926625319 2:15085624-15085646 GGGTGGCTGCAGCTGTGCTCAGG - Intergenic
926699049 2:15790527-15790549 GGGTGTCCGCAGCTCCGCTCTGG - Intergenic
926859394 2:17292263-17292285 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
927072801 2:19548104-19548126 GGGTGGCTGTAGCCCCACCCAGG - Intergenic
927135208 2:20091958-20091980 GTGAGGGAGCAGCTGCGCCCGGG + Intergenic
927236579 2:20880497-20880519 GGGCGGCTGCAGCTGCGCCCAGG + Intergenic
927533998 2:23837481-23837503 GGGCGGCTGCAGCTGCACCCAGG + Intronic
927613669 2:24566960-24566982 GGGCAGTTGCAGCTGCACCCAGG + Intronic
927694209 2:25229401-25229423 GGGAGGTTTCAGCTGCTCCCTGG + Exonic
927743309 2:25591258-25591280 GACCGGCTGCAGCTGCGCCCAGG + Intronic
928470382 2:31569064-31569086 GGGTGGCTGCAGCTGCGCCAAGG + Intronic
928840368 2:35598607-35598629 GGGTGTCTGCAGCTCTGCCTGGG - Intergenic
928946756 2:36778706-36778728 GGGCTGTTGCAGCTGTGCCCAGG - Intronic
929014460 2:37481219-37481241 GGGAGGCTGCACCTGCATCCAGG - Intergenic
929769169 2:44877670-44877692 GGATGGCTGCAGCTGGCCCTGGG - Intergenic
929847255 2:45542406-45542428 GGGCAGCTGCAACTGCGCCCAGG + Intronic
930611900 2:53553778-53553800 GGTTGGCTGCAGCTGCACCTAGG - Intronic
930800448 2:55438060-55438082 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
931282281 2:60804753-60804775 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
931499935 2:62854986-62855008 GGGCAGCTGAAGCTGCACCCAGG - Intronic
931707438 2:64958783-64958805 GGGTGGCTTCAGCTTGGCTCAGG + Intergenic
931734045 2:65177955-65177977 GGGCAGCTGCAGCTGTGCCCCGG + Intergenic
932054870 2:68433424-68433446 GGGTGGCTGCAGTTGCCTCTGGG + Intergenic
932501708 2:72188033-72188055 GGGTGGCTGCAGCTGTGCTGGGG + Intronic
932501728 2:72188118-72188140 GGGTGGCTGCAGTTGTGCCCAGG + Intronic
932644751 2:73488509-73488531 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
932761569 2:74441645-74441667 AGGTGGCTGGGGCTGCCCCCGGG + Intronic
933379453 2:81524317-81524339 GGGTGGCTGCAGGTGAGGTCTGG - Intergenic
933606626 2:84390244-84390266 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
933780196 2:85795858-85795880 TGGGGGCTGCAGATGGGCCCTGG - Intergenic
933801263 2:85961839-85961861 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
933804020 2:85984891-85984913 GGGTGCCTGCAGCTTCTCCCAGG + Intergenic
934696637 2:96404971-96404993 GGGCAGCTGCACCTGCACCCAGG + Intergenic
935518858 2:104078777-104078799 CGGTGGCTGCAGCTGTGCCCAGG + Intergenic
935667453 2:105525196-105525218 GGGTGGCTGCAGTTCTGCCTGGG - Intergenic
936057258 2:109270416-109270438 GGGTGCCTGCAGCTGCCACAGGG + Intronic
936290210 2:111217178-111217200 AGGTGGCTGCAGCTGCACCCAGG + Intergenic
937737707 2:125312555-125312577 GGGCGACTGCAGCTGAGCCCAGG - Intergenic
938096549 2:128467649-128467671 GGGCAGCTGTAGCTGCACCCGGG + Intergenic
938527394 2:132146416-132146438 GGGTGGCAGCAGCTGCCCGAGGG + Intergenic
938732675 2:134158609-134158631 GGGTGGCTGCAGCTGCATCCAGG + Intronic
939085063 2:137708562-137708584 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
939801766 2:146720247-146720269 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
940422930 2:153499896-153499918 GGGCAGCTGCAGCTGAACCCAGG + Intergenic
940423887 2:153509260-153509282 GGGCAGCTGCAGCTGCGTCAGGG + Intergenic
940582725 2:155601444-155601466 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
940694406 2:156960013-156960035 GGGTGGCTGCAGCTGTGACTGGG + Intergenic
941404707 2:165074403-165074425 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
941440438 2:165528905-165528927 GGGTGGCTACAGTGGCACCCGGG - Intronic
941440466 2:165528994-165529016 GGGCAGCTGCAACTGCACCCAGG - Intronic
941929320 2:170924633-170924655 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
942054833 2:172172705-172172727 GCACGGCTGCAGTTGCGCCCGGG - Intergenic
942103909 2:172613969-172613991 CGGCAGCTGCAGCTGCACCCAGG - Intergenic
942114463 2:172713749-172713771 GGGTGGCTGCAGCTGTGTCCGGG + Intergenic
942585172 2:177466865-177466887 GGGTGGCTGCAGCTGTGTCCAGG + Intronic
942730041 2:179053619-179053641 GGGTGGCAGCAGCTGCTGCACGG + Intergenic
943189895 2:184663139-184663161 GGGTGGCTGCAGCTGTGGCCAGG - Intronic
943226416 2:185184953-185184975 GGGCAGCTGAAGCTGTGCCCAGG - Intergenic
943345759 2:186735043-186735065 GACAGGCTGCAGCTGTGCCCAGG + Intronic
943396281 2:187338915-187338937 GGGCAGCTGCAGCTGCGCCCAGG + Intergenic
943427098 2:187750399-187750421 GAGTGGCTACAGTTGCGCCCAGG + Intergenic
943427117 2:187750489-187750511 GGGAGGCTGCAGCTGTGCCCAGG + Intergenic
943820477 2:192315004-192315026 GGGCAGCTGCAGCTACGCCCAGG + Intergenic
943827400 2:192413924-192413946 GGATGGCTGCAGCTGCCCCCAGG - Intergenic
943858308 2:192827962-192827984 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
944121404 2:196244474-196244496 GAGTAGCTGCAGCTGCCCGCTGG - Intronic
944146650 2:196514054-196514076 GGGTGGCTGCTGCTGTACCTGGG - Intronic
944483715 2:200182040-200182062 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
944586573 2:201178664-201178686 GGGTGGCTGCAGCCACACCCTGG - Intergenic
945234820 2:207624780-207624802 GGCTGGCTGCAGCTGCAGTCCGG - Intronic
945258130 2:207819351-207819373 AGTTGCCTGCAGCTGCGACCTGG + Intergenic
946495481 2:220192004-220192026 GGGTGACTGCATCTGTGCCCGGG - Intergenic
946789452 2:223285428-223285450 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
946789477 2:223285545-223285567 TGGTGGCTGCAGCTACACCCAGG + Intergenic
947054904 2:226088491-226088513 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
947327436 2:228993176-228993198 GGGTGGCTGCAGTTGCACCCAGG + Intronic
948214980 2:236221927-236221949 GGGTGGCTGCAGCTGAAGGCTGG + Intronic
948293634 2:236845465-236845487 GGGTGGCCACAGCTGCACCTGGG + Intergenic
948434425 2:237943667-237943689 GAGTGGCTGCAGCTGCGCCTGGG - Intergenic
948575529 2:238947173-238947195 GGGTGGCTACAGCTGTGCCTGGG + Intergenic
948587026 2:239026065-239026087 GGGTGGCTGCAGCTGTGCCCCGG + Intergenic
948696877 2:239737254-239737276 TGGTGGCGGCAGCGGGGCCCCGG - Intergenic
948706014 2:239792894-239792916 GGGAGTCTGCAGCTGCTCCTCGG + Intronic
948850890 2:240704739-240704761 GCGGGGCTGCCGCTGCTCCCGGG + Intergenic
948856014 2:240730972-240730994 GGGAGCCTGCAGCTGCCCTCAGG - Intronic
949026841 2:241770332-241770354 GGGTGGCTGCTGCTGGCCCAGGG + Intergenic
1168748288 20:263703-263725 GAGTGGCTGCAGTTGCACCTGGG - Intergenic
1168983517 20:2027348-2027370 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1169122852 20:3107719-3107741 GGGTGGCTCCACCTGTACCCAGG + Exonic
1169345173 20:4823391-4823413 GGGCTGCTTCAGCTGCGCCTCGG + Intronic
1169880394 20:10341191-10341213 GGGTGGCTGCAGCAATGCCCAGG - Intergenic
1170150331 20:13221195-13221217 GGAGGGCTTCAGCTGCGGCCGGG - Intergenic
1170221444 20:13946666-13946688 GGGCGGCTACAGCTGTGCCCAGG - Intronic
1170494890 20:16915044-16915066 GGGTGGCAGCAGCACCTCCCAGG - Intergenic
1171536615 20:25898534-25898556 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1171839556 20:30193799-30193821 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1172136683 20:32690906-32690928 GGCTGGCGGCTGCTGCTCCCAGG + Intergenic
1172245642 20:33443568-33443590 GGGCTGCTGGAGCTGCGCGCCGG - Exonic
1172346932 20:34209441-34209463 GGGTGGCTGTAGCTGCATCCAGG - Intronic
1172676620 20:36677160-36677182 GGGCGGCTGCAGCTGCACCTGGG - Intronic
1173524544 20:43721720-43721742 GGGCCGCTGCAGCTGCACCCAGG + Intergenic
1173893763 20:46534192-46534214 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
1173893784 20:46534271-46534293 GGATGGCTGCAGCTACCCCCAGG - Intergenic
1175064310 20:56272390-56272412 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1175335375 20:58192745-58192767 GGGCCGCTGCAGCAGTGCCCAGG + Intergenic
1175675767 20:60945572-60945594 GGGCAGCTGCAGCGGCACCCAGG - Intergenic
1175702681 20:61151586-61151608 CGGTGGCTGGAGCTGCACCTGGG + Intergenic
1175815349 20:61880659-61880681 GGGTGGCGGCCTCTGCGTCCTGG - Intronic
1175859403 20:62142591-62142613 GGGCGGCTGCAGCCCGGCCCCGG + Intronic
1175892579 20:62322109-62322131 GGGCCGCTGCAACTGCCCCCCGG - Exonic
1175897490 20:62345831-62345853 GGCTGGCAGCACCTGCTCCCTGG + Exonic
1175915193 20:62422813-62422835 GGGTGGCTGCAGCGTCCCCAGGG + Intronic
1175960042 20:62631354-62631376 GGGTGGCCGCAGTTGTGCCTGGG + Intergenic
1176239403 20:64068959-64068981 GGGCAGCTGCAGCTGCTGCCTGG - Intronic
1176599174 21:8776007-8776029 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1176628878 21:9119057-9119079 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1176645122 21:9342286-9342308 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1176769129 21:13053587-13053609 GGGTGGCAGCAGCTGCCCGAGGG - Intergenic
1176790201 21:13311143-13311165 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
1176790221 21:13311224-13311246 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
1177037523 21:16061365-16061387 ATGTGGCTGCAGCCGTGCCCAGG + Intergenic
1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG + Intergenic
1177344742 21:19854356-19854378 GGATGGCTGCAGCTGCGTCCTGG + Intergenic
1177357933 21:20032190-20032212 GGGTGGCTGCAGCTGTACCTGGG + Intergenic
1177396168 21:20538406-20538428 GGGTGGCTGCAGCTGCGCCCAGG + Intergenic
1177396187 21:20538487-20538509 GGGCAGCTGCAGCGGCACCCGGG + Intergenic
1177989394 21:28019433-28019455 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
1178244270 21:30936245-30936267 GGGTGGCTACAGTTGCTCCTGGG - Intergenic
1178931164 21:36820340-36820362 GGGCAGCAGCAGCTGCGCCTGGG - Intronic
1178937310 21:36874808-36874830 GGGTGGCCGCAGCTGCACCTGGG - Intronic
1179585068 21:42369634-42369656 GAGCGGCTGGAGCTGCCCCCGGG + Intergenic
1179775545 21:43659610-43659632 GGCTGGCTGCAGCGGCACCGCGG + Exonic
1179960473 21:44764708-44764730 GGGTGGATGGAGCCGCACCCTGG - Intergenic
1179980821 21:44894833-44894855 GGGAGGCTGCAGCTGGCCCACGG + Intronic
1180025770 21:45161258-45161280 GGACGGCTGCAGCTGTGCCCAGG - Intronic
1180091519 21:45535992-45536014 TGGTGGCTGCCCCTGCACCCCGG + Intronic
1180096197 21:45556170-45556192 GGGTGGCTGCAGCCACCCCGGGG + Intergenic
1180326636 22:11435626-11435648 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1180367833 22:11956948-11956970 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1180378256 22:12114386-12114408 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1180419252 22:12798893-12798915 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1180433685 22:15279747-15279769 GGGTGGCAGCAGCTGCCCAAGGG - Intergenic
1180516239 22:16147656-16147678 GGGTGGCAGCAGCTGCCCGAGGG - Intergenic
1180765091 22:18341516-18341538 GGGGGTCTGCAGATCCGCCCAGG - Intergenic
1180813938 22:18778168-18778190 GGGGGTCTGCAGATCCGCCCAGG + Intergenic
1180833513 22:18918559-18918581 TGGTGACTGCACCTGGGCCCAGG - Intronic
1180955513 22:19739601-19739623 GGGTGGCTGGTCCTGCGTCCCGG + Intergenic
1181066314 22:20307696-20307718 TGGTGACTGCACCTGGGCCCAGG + Intergenic
1181200123 22:21212503-21212525 GGGGGTCTGCAGATCCGCCCAGG + Intronic
1181527605 22:23499139-23499161 GGGTTGCTCCTGCTGTGCCCAGG - Intergenic
1181557893 22:23682553-23682575 AGGTGGCTGCAGGTCCCCCCAGG - Intergenic
1181661286 22:24351047-24351069 GGTTGGCTTCAGCTGAGCTCAGG - Intronic
1181701612 22:24624456-24624478 GGGGGTCTGCAGATCCGCCCAGG - Intronic
1182510817 22:30818901-30818923 GGAGGGTTGCAGCTGCCCCCGGG + Intronic
1182805202 22:33063933-33063955 GCCTTGCTGCAGCTGCTCCCTGG - Intergenic
1183025067 22:35058697-35058719 GGGTGGCTGAAGCTGTGCCTGGG + Intergenic
1183316721 22:37141163-37141185 GGGTGGCTGCAGCTGCGCCCAGG - Intronic
1183316752 22:37141292-37141314 GGGTAGCTGCAGCTGTGCCCGGG - Intronic
1183350328 22:37331223-37331245 GGGAGGCTGCAGCTGGGCGTGGG - Intergenic
1183934512 22:41254611-41254633 GGGTGGGAGCACCTGCTCCCAGG + Intronic
1184054521 22:42035421-42035443 GGGCGGCTGCAGCAGCATCCAGG + Intronic
1184173770 22:42774618-42774640 GGGTGGCTGCAGTGGCACCCAGG - Intergenic
1184175907 22:42788562-42788584 GGGTGGCTGCAGGTGAGGCTGGG + Intergenic
1184247601 22:43243538-43243560 CAGTGGCTGCAGCTGTTCCCAGG - Intronic
1184381467 22:44147394-44147416 AGGAGGCTGCAGCTGCTCCCAGG + Intronic
1184477552 22:44729738-44729760 GTGTGGCTCCAGCTGGGGCCTGG + Intronic
1184561030 22:45263024-45263046 GGGCGGCTGCAGCTGCACCTGGG + Intergenic
1184613501 22:45622046-45622068 GGGTGGCTGCAGAAGCACCTGGG - Intergenic
1184665624 22:45987442-45987464 TGGTGGCTGCAGCTGTGCCTGGG - Intergenic
1184843146 22:47064181-47064203 GGGTGCCGGCAGCGGCTCCCCGG - Intronic
1184869529 22:47226406-47226428 GGATGGCTGCAGCTGCACCCAGG + Intergenic
1184869556 22:47226497-47226519 GGGTGGCTGCAGAGGCACCCTGG + Intergenic
1185214269 22:49589660-49589682 AGGTGGCTGCAGCAGCCCCGGGG - Intronic
1185323037 22:50210563-50210585 GGGTGGCTGCACCATCTCCCGGG + Intronic
1185343402 22:50301270-50301292 AGGGGGCTGCAGCTGTGCCCAGG - Intronic
1203226713 22_KI270731v1_random:82421-82443 GGGGGTCTGCAGATCCGCCCAGG - Intergenic
1203264037 22_KI270734v1_random:3855-3877 GGGGGTCTGCAGATCCGCCCAGG + Intergenic
1203283598 22_KI270734v1_random:143857-143879 TGGTGACTGCACCTGGGCCCAGG - Intergenic
949226234 3:1699438-1699460 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
950207532 3:11092241-11092263 GGGAGTGTGCAGCTGCGCCCAGG - Intergenic
950376256 3:12574711-12574733 GTGTGGCTGCAGCTACTCCTAGG + Intronic
950534301 3:13570423-13570445 GCGTGGCCGCAGCTGCCCCTCGG + Exonic
950575252 3:13828339-13828361 GGGTGCATGCAGCTGGGTCCTGG + Intronic
950640490 3:14345282-14345304 GGGAGGCTGCTGCTGCTCCGGGG + Intergenic
951264831 3:20552926-20552948 GGGCGGCTGAAGCTGCACCAGGG + Intergenic
951316068 3:21191054-21191076 GGGTGGCAGCAGCTGCTGCACGG + Intergenic
951718572 3:25674333-25674355 GAGTGGCTGCAGCTGTGCCTGGG + Intergenic
951798323 3:26566767-26566789 GGGTGGCTGTAGCCCCGCGCAGG + Intergenic
952016023 3:28958747-28958769 CAGTGGCTGCAGTTGCACCCAGG - Intergenic
952269536 3:31817723-31817745 GGGTGACTGCAGCAGCACCCGGG + Intronic
952657384 3:35802129-35802151 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
952793234 3:37217165-37217187 GGGCAGCTGCGGCTGCGCCCAGG - Intergenic
953414734 3:42709164-42709186 GTGTGGCTGGAGCTGCACACAGG + Intronic
953602956 3:44386488-44386510 GGGTAGCTGCAGCTGCACCAGGG - Intronic
953748298 3:45591610-45591632 GGGTGGATGCAGCTGTGCCTGGG + Intronic
953801934 3:46031217-46031239 GGGTGGCTGTAGCAGTGCCTTGG - Intergenic
954099446 3:48358055-48358077 GAGCGGCTACAGCTGCACCCAGG + Intergenic
954317726 3:49810393-49810415 AGGTGGCTGCAGCAGCTGCCCGG - Exonic
954375914 3:50194057-50194079 GGGGGCCTGAACCTGCGCCCCGG - Intronic
954400891 3:50318988-50319010 GGATGACACCAGCTGCGCCCAGG + Exonic
954594846 3:51815593-51815615 GGGAGGCTGCAGTGGAGCCCTGG - Intergenic
954651007 3:52162637-52162659 GGGTGGCTGTAGCCCTGCCCAGG + Intergenic
954706166 3:52481720-52481742 GGCTGCCTGCAGCTGCAGCCTGG - Intronic
955112000 3:55958898-55958920 GGGAAGCTGCAGCTGTGCCCAGG + Intronic
955303707 3:57809177-57809199 GTGTGGCTGCAGCTGCACCTGGG - Intronic
955424920 3:58778158-58778180 GGGTGGCTGTAGCTGCACTTTGG - Intronic
956462451 3:69485448-69485470 GGGTGGCTGCAGCCCTGCTCAGG + Intronic
956696983 3:71926851-71926873 GGCTGCCTTCAGCTGTGCCCTGG + Intergenic
956990115 3:74752391-74752413 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
957095204 3:75771758-75771780 GGATGGCTGCAGCTGTGCCTGGG - Intronic
957350714 3:79019262-79019284 GGGTGCAGGCAGCTGCCCCCAGG - Intronic
957613946 3:82505308-82505330 GGGTGGCTTCAGCTTCGCCTGGG - Intergenic
957624373 3:82640559-82640581 GGGTGGCTACAGCTGTGCCTGGG - Intergenic
957625763 3:82650565-82650587 GGGCAGTGGCAGCTGCGCCCGGG - Intergenic
957625781 3:82650648-82650670 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
957653231 3:83035744-83035766 GGGCAGCTGCAGCTGCACCTAGG + Intergenic
957665440 3:83218980-83219002 GGCTGGCTGCAGCTGTGTCCTGG + Intergenic
957730222 3:84125307-84125329 GGGTGGCTGCAGCTGCACCCTGG - Intergenic
957775983 3:84757431-84757453 GGGCGGCTACTGCTGCACCCAGG + Intergenic
957922973 3:86771743-86771765 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
958019758 3:87980977-87980999 GGGGGGCTGCTGCTGCACCTGGG + Intergenic
958141919 3:89572048-89572070 GGGAGGCTGCAGCTGTGCTCAGG + Intergenic
958161321 3:89819156-89819178 GGGCAGCTGCAGCTGTGTCCAGG + Intergenic
958195208 3:90235256-90235278 GGGCAGCTGCAGCTGCACTCAGG - Intergenic
958418621 3:93906661-93906683 GGGCAGCTGCAGCTGCACTCAGG - Intronic
958562140 3:95760055-95760077 AGGTGGCTTCAGCTGTGCCCAGG + Intergenic
958584570 3:96069516-96069538 GGGTGGCTGCAGCTGCTCCCGGG + Intergenic
959530671 3:107431324-107431346 GGGTGGCTGCAGGTGCCCAGTGG + Intergenic
960096615 3:113696265-113696287 GGGTGGGTGGAGCTGAGCCCGGG + Intronic
960097062 3:113699039-113699061 GGGTGGGTGGAGCTGAGGCCGGG - Intergenic
960634391 3:119768741-119768763 GGGTGGCTGCAGTGGCACCGGGG + Intergenic
960690498 3:120341947-120341969 GGACGGCTGCAGCTGCTCGCGGG - Intronic
961311278 3:126003714-126003736 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
961487634 3:127227741-127227763 CTGTGGCTGCAGCTGGGGCCAGG + Intergenic
961493477 3:127273996-127274018 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
961493519 3:127274166-127274188 GGGTGGCTGCAGCTGCGCCCAGG - Intergenic
961525720 3:127496200-127496222 GGATGGCTGCAGCTGCACCCAGG - Intergenic
962105381 3:132383559-132383581 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
962786075 3:138769059-138769081 GGGTAGCTGCAGCTGCTCCTGGG + Intronic
962824633 3:139089011-139089033 GAGCAGCTGCAGCTGTGCCCAGG + Intronic
962824651 3:139089092-139089114 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
962824675 3:139089183-139089205 GGGTGGCTGCAGCAGCACCTGGG + Intronic
963199074 3:142568621-142568643 GGGCGGCTGCAGCTGCACCCAGG - Intronic
963250081 3:143095302-143095324 GGGTGGCTACAGTTGCACCCAGG - Intergenic
963346178 3:144098911-144098933 CCGCGGCTGCAGCTGCTCCCAGG - Intergenic
963483205 3:145903686-145903708 GGGTGGCTGCAGCGGCACCCAGG - Intergenic
963906217 3:150775145-150775167 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
964255134 3:154766886-154766908 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
964791954 3:160460752-160460774 GGGTGGCTGCAGCCCCGTCCAGG + Intronic
964927375 3:161975408-161975430 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
964927940 3:161979439-161979461 AGGTGGTTGCAGCTGTGTCCAGG + Intergenic
965051497 3:163655231-163655253 GGGTGGCCACAGCTGTGCCCGGG + Intergenic
965074072 3:163953865-163953887 GAGTGGCAGCAGCTGTGCCTTGG + Intergenic
965114951 3:164477356-164477378 AGGTGCCTGCAGCTGCACCTGGG - Intergenic
965205286 3:165713637-165713659 GGGTGGCTGCAGCCACACCTGGG + Intergenic
965206263 3:165721287-165721309 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
965261250 3:166489232-166489254 GGGTGACTGCAGCTGCACCTGGG - Intergenic
965335371 3:167426612-167426634 GGGTGGCAGCAGCTGCTGCACGG - Intergenic
965774099 3:172210099-172210121 GGGTGGCTGCAGCTGTGCCCAGG + Intronic
965793213 3:172411422-172411444 GGGTGGCTGAAGCCCTGCCCAGG + Intergenic
965793237 3:172411511-172411533 AGGTGGCTGCAGTTGCACCTGGG + Intergenic
965924400 3:173959108-173959130 GGGTGGCTGCAGCTGTGCCCAGG + Intronic
966067076 3:175831529-175831551 GGGTGGCAGCAGCTGCTGCACGG - Intergenic
966491333 3:180531507-180531529 CGGTGGCTGCAGTGGCACCCAGG - Intergenic
966491393 3:180531782-180531804 GGCAGGCTGCAGCTGCACCTGGG - Intergenic
966840032 3:184081074-184081096 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
967207768 3:187139354-187139376 AGGTGGCTGCAGCTAGGCCGGGG - Exonic
967649990 3:191974004-191974026 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
967896043 3:194396961-194396983 GGGTGGCTGCGGCAGCACCTAGG - Exonic
1202741770 3_GL000221v1_random:62782-62804 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
968451385 4:677594-677616 GGGTGACTGCAGCTGGTCACCGG - Intronic
968514539 4:1010706-1010728 GGGCGGCTGGAGGTGCGGCCTGG + Intronic
968538777 4:1151618-1151640 GGGTGGCTGTAGCTGCGCCTAGG + Intergenic
968538824 4:1151845-1151867 CAGTGGCTGCAGCTGTGCCCAGG + Intergenic
968556737 4:1249488-1249510 GGGCGGCTGCGGCTGCGGCGCGG - Intronic
968793969 4:2689786-2689808 AGCTGGCTACAGCTGCGCCAGGG - Intronic
968980889 4:3848823-3848845 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
969750433 4:9106408-9106430 GGGTGGCAGCAGCTGCTGCACGG - Intergenic
970333069 4:15003911-15003933 GGGCGGCTGCGGCTGCGGCTGGG - Exonic
971092323 4:23360426-23360448 GGGTGGCTGCAGCTGCACTCAGG - Intergenic
971867247 4:32189293-32189315 GAATGGCTGCAGCTGTGCCCAGG - Intergenic
972075161 4:35078805-35078827 GGATGACTGCAGCTGTGCCTAGG - Intergenic
972106359 4:35493999-35494021 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
972128449 4:35800767-35800789 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
972645730 4:40966475-40966497 GGGTGGCTGTAGCTGCGCCCAGG - Intronic
973267535 4:48226021-48226043 GGGTGGCTGAGGCTGCTCCAAGG + Intronic
973362535 4:49178380-49178402 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
973398566 4:49618481-49618503 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
974179058 4:58360914-58360936 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
974278539 4:59759476-59759498 GGACAGCTGCAGCTGTGCCCAGG + Intergenic
974278559 4:59759568-59759590 GGGTGGCTGCAGCCCTGTCCAGG + Intergenic
974683598 4:65195495-65195517 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
975040967 4:69743927-69743949 GGGTGGCTGCAGATGTTCCCAGG + Intronic
975254440 4:72216671-72216693 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
975321206 4:73011654-73011676 GGGTGGCCACAGCTGCACCCAGG - Intergenic
975321226 4:73011752-73011774 GGGTGCCTGCTGCTGCTGCCTGG + Intergenic
975910172 4:79258279-79258301 GGGTAGCTGCCACTGCTCCCAGG - Intronic
976097915 4:81528517-81528539 GGGTGGCTGCAGCTGTACCCAGG + Intronic
976129570 4:81870511-81870533 GGGCAGCTGCAGCTGCACCCAGG - Intronic
976680052 4:87746080-87746102 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
976728989 4:88244107-88244129 GGGCGGCTGCAGCTGCACCCGGG - Intergenic
976734579 4:88296791-88296813 GGGTGGCTGCAGCTGCACTGGGG + Intergenic
977410183 4:96653069-96653091 GGGCAGCTGCAGCTGCTCCCAGG - Intergenic
977487436 4:97666140-97666162 AGGTGGCTGCAGTTGCACCCAGG + Intronic
978061351 4:104344521-104344543 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
978149466 4:105415607-105415629 GTGTGGCTGCAGCTGTGTCCAGG + Intronic
978347749 4:107789037-107789059 AGGTGGCTGCAGCTGTGCCCAGG + Intergenic
978498347 4:109384079-109384101 GGGAGGCTGCAGCTGTGCCCAGG - Intergenic
978498370 4:109384169-109384191 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
978663525 4:111155057-111155079 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
978943376 4:114464647-114464669 AGGTGTCTGCCACTGCGCCCTGG + Intergenic
978964647 4:114725864-114725886 GGGTGGCTTCAGCTGCACCCAGG + Intergenic
978964683 4:114726013-114726035 GGGTGGCAGCAGCGGCATCCAGG + Intergenic
979010693 4:115365442-115365464 GGGCAGCTGCAGCTACGCCTGGG - Intergenic
979638052 4:122978992-122979014 GGGCAGCTGCAGCTGTGCCTGGG + Intronic
980180067 4:129392117-129392139 GGATGGCTGCAGTGGCACCCAGG - Intergenic
980180115 4:129392308-129392330 GGGTAGCTGCAGCTGTGCCTGGG - Intergenic
980574468 4:134666826-134666848 GGGCAGCCGCAGCTGGGCCCAGG + Intergenic
980703035 4:136457302-136457324 GGGTGGCTGCAGTTGTGCCCAGG - Intergenic
980703053 4:136457393-136457415 GGGTGGCTGCAGCTGCACCCAGG - Intergenic
980731041 4:136824325-136824347 GGGCGGCTGCAGCTGCACCCTGG + Intergenic
980738124 4:136917495-136917517 GGGTAGCTGCAGCTGCACCCAGG - Intergenic
980740644 4:136946381-136946403 GGGTGGTTGCAGCTGCGCCCAGG - Intergenic
980750200 4:137077527-137077549 GGGTGGCTGTAGCCCCACCCAGG + Intergenic
982545062 4:156724053-156724075 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
982545092 4:156724173-156724195 GGGCGGCTGCAGCTGTGTCCAGG - Intergenic
982610943 4:157574389-157574411 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
982994086 4:162318052-162318074 GGGTGGCAGCAGCTGGCACCAGG + Intergenic
983323696 4:166227126-166227148 GGGTGGCTGTGGCTGTGCCAGGG - Intergenic
983380237 4:166982063-166982085 GGCTGGCTGCAGCTGTGCCCAGG + Intronic
983491736 4:168397871-168397893 GGGTGGCTACAGCTGTGCCTGGG - Intronic
983651396 4:170040265-170040287 GGGCGGCTGCAGCTGCGAAGTGG - Intergenic
983885523 4:172975969-172975991 GGGTTGCTGCAGCTGCGCCAGGG + Intronic
984115253 4:175671915-175671937 GGGTGGCAGCAGCTGCTGCGTGG - Intronic
984170302 4:176350801-176350823 GAGCAGCTGCAGCTGCACCCTGG + Intergenic
984325081 4:178241582-178241604 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
984375234 4:178921831-178921853 AGGGGGCTGCAGCTGTACCCAGG - Intergenic
984763665 4:183383667-183383689 GGGTGGCTATGGCTGTGCCCGGG - Intergenic
1202759875 4_GL000008v2_random:99850-99872 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
985586969 5:745506-745528 AGGGGTCTGCAGCTGCGACCTGG + Intronic
985601541 5:837688-837710 AGGGGTCTGCAGCTGCGACCTGG + Intronic
985611714 5:892948-892970 AGGTGGCGGCGGCCGCGCCCTGG + Exonic
985666488 5:1183944-1183966 GGGAGCCTGGGGCTGCGCCCGGG - Intergenic
985916045 5:2919879-2919901 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
985996481 5:3599991-3600013 GGGGTGTTGCAGCGGCGCCCCGG - Exonic
986200292 5:5573178-5573200 GGGTCTCTGCCGCTGCACCCAGG - Intergenic
986215171 5:5712955-5712977 GGGTGGCCACAGCTGCACCCAGG + Intergenic
986402724 5:7395878-7395900 GAGGGGCTCCCGCTGCGCCCCGG - Intergenic
987288815 5:16488375-16488397 GGGTTGCTGCCCCTGCTCCCAGG - Intronic
987401142 5:17478224-17478246 TGGTGGCTGCAGCTGTCCCTTGG + Intergenic
987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG + Intergenic
987875310 5:23674429-23674451 GGGTGGCTGCAGCCTTACCCAGG - Intergenic
987999480 5:25330668-25330690 GGGTGGCTGCAGCTGCACCAGGG - Intergenic
988109939 5:26807425-26807447 GGGCATCTGCAGCTGTGCCCAGG - Intergenic
988202156 5:28082868-28082890 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
988225188 5:28404410-28404432 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
988225253 5:28404660-28404682 GGGTAGCTGCAGCTGTACCCGGG - Intergenic
988346270 5:30041817-30041839 GGGTGACTGCATCTGTGCCCAGG - Intergenic
988566026 5:32320604-32320626 GGGTGGCTGCAGCCACTCCTGGG + Intergenic
989279286 5:39622334-39622356 GGGAGGCTGCAGTTGCACCCAGG + Intergenic
989339058 5:40354190-40354212 GGGCAGTTGCAGCTGCGCCCAGG - Intergenic
989523097 5:42423826-42423848 CGGCGGCTGCTGCTGAGCCCGGG + Intronic
989821580 5:45800104-45800126 GGGTGGCTGCAGCTGTACCCAGG - Intergenic
989983090 5:50666592-50666614 GGGCGGCGGCAGCCGTGCCCAGG - Intronic
990023623 5:51159543-51159565 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
990639067 5:57761911-57761933 GGGTGGCCGCAGCAGCACCTGGG - Intergenic
990878655 5:60516944-60516966 GGGTGGCTGCAGCTGTGCCCAGG - Intronic
990923594 5:60994397-60994419 GGGCAGCTGCAGCTGCACCTGGG + Intronic
991107735 5:62862519-62862541 GGGTGGCTGCAGATGCATCCAGG + Intergenic
991230772 5:64330871-64330893 GGGTGGCTGCAACTTTGCCTGGG - Intronic
991359395 5:65803570-65803592 GGGTAGCTGTAGCTACACCCAGG + Intronic
991359439 5:65803752-65803774 GGGCAGCTGCAGCTATGCCCAGG + Intronic
991472238 5:66981505-66981527 GGATGGCAGCACCTGCGCCAGGG + Intronic
992074927 5:73183690-73183712 CAGTGGCTGCACCTGCCCCCTGG + Intergenic
992244116 5:74800117-74800139 GGCTGACTGCAGCTGTGCCGTGG + Intronic
992839026 5:80668748-80668770 CTGTGGCTGCAGCTGCACCCAGG + Intronic
993618141 5:90137347-90137369 AGGTGGTTGCAGTTGCACCCCGG + Intergenic
994240079 5:97408579-97408601 GGGTGGCTGCAGTTGCACCCGGG + Intergenic
994245513 5:97471623-97471645 AGGTGGCTACAGCTGCACCTGGG + Intergenic
994451478 5:99950180-99950202 GGGCAGCTGCAGCTGCGCCCAGG - Intergenic
994517868 5:100793825-100793847 GGGTGGCTGCAGCTGCACTAGGG - Intergenic
994725854 5:103434397-103434419 CGGAGGCTGCAGCTGCACCCAGG - Intergenic
994753331 5:103764801-103764823 CTGTAGCTGCAGCTGCGCCCAGG + Intergenic
994790931 5:104224400-104224422 GGGAGGCTGCAGCTGCACCCTGG + Intergenic
994916106 5:105982387-105982409 GGGAGGCTGCAGCTGCACCAGGG - Intergenic
995145915 5:108787064-108787086 GGGCAGCTGCAGCTGCACCCAGG - Intronic
995723901 5:115165735-115165757 GGGTGGCTGCAATTGCACCCAGG - Intronic
995745030 5:115394060-115394082 GGGTGGCTGCAACTGCACCCTGG + Intergenic
995835425 5:116395629-116395651 GGGTGGCTGCGGCTGCTCTGAGG + Intronic
995926923 5:117385983-117386005 GGGTGGCTGCAGCTGCACCCAGG - Intergenic
996176653 5:120368127-120368149 GTGAGGCTGCAGCTGTGCCTGGG - Intergenic
996183737 5:120451495-120451517 GGACGGCTGCTGCTGCACCCAGG + Intergenic
996183755 5:120451585-120451607 AGGTGCCTGCAACTGCGCCCAGG + Intergenic
996923939 5:128800426-128800448 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
996923960 5:128800518-128800540 GGGCGGCTGCAGCCCCACCCAGG + Intronic
997129616 5:131263944-131263966 CGGTCGCTGCAGCTGCGCAACGG + Intronic
997960334 5:138316119-138316141 GGGCAGCTGCAGCTGCACCCGGG - Intronic
998449882 5:142226010-142226032 GGGTGGCAGGAGCGGCCCCCCGG + Intergenic
998480633 5:142459714-142459736 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
998675226 5:144400416-144400438 GGGTCCCTGCAGCTGTGCTCTGG - Intronic
998792183 5:145777673-145777695 GGGTGGCTGTAGCTGCGCGCAGG - Intronic
999799521 5:155019877-155019899 GGGCGGCCGCAGCTGCTCCCGGG + Intergenic
999859768 5:155633243-155633265 GGGTGGCTACAGTGGCACCCAGG - Intergenic
999859837 5:155633539-155633561 GGGTGGCCACAGCTGTACCCAGG - Intergenic
999887299 5:155937178-155937200 GGGTGGCTGCAGCTGTGCTTGGG + Intronic
1000266157 5:159640534-159640556 GGGCAGCTGCAGCTGCACTCAGG - Intergenic
1000426140 5:161093491-161093513 GGGCAGCTGCAGCTGCACCCTGG - Intergenic
1000854347 5:166379828-166379850 GGGTAGCTGCAGCTGCGCCCAGG + Intergenic
1001422092 5:171595849-171595871 GGTTTGCTGCAGCTGGACCCTGG + Intergenic
1001993378 5:176134891-176134913 GGCTGGCTGCCCCTGCTCCCAGG - Intergenic
1002072494 5:176688455-176688477 GGGCGGTTGCAGCTGCACCCAGG + Intergenic
1002102141 5:176862907-176862929 AGGAGCCTGCAGCTGCCCCCAGG + Intronic
1002427668 5:179185695-179185717 GGGTCGAGGCAGCTGAGCCCTGG + Intronic
1002598018 5:180336783-180336805 GGCTGGGGGCAGCTGCGGCCTGG - Intronic
1002688887 5:181036978-181037000 GGGTGACTGCAGCGGTACCCGGG - Intergenic
1002688957 5:181037274-181037296 GGGTGGCCGAAGCTGCACCCGGG - Intergenic
1003073950 6:2967140-2967162 GGGTGGCTGGAGCTCTGCACTGG - Intronic
1003178550 6:3771999-3772021 GGGCAGCTCCACCTGCGCCCCGG + Intergenic
1003624468 6:7728696-7728718 GGATGGTTGCAGCTGCGCGGCGG + Intronic
1003923440 6:10855438-10855460 GGGAGGCTGTAGCCCCGCCCAGG - Intronic
1004304333 6:14487038-14487060 GGGTGGCTGCAGTGGCACCTAGG - Intergenic
1004304358 6:14487121-14487143 GGATGGCTGTAGCTGCACCCAGG - Intergenic
1004520746 6:16358961-16358983 GGTTGGCCACAGCTGCACCCGGG - Intronic
1004528693 6:16433799-16433821 GGGTCTCAGCAGCTCCGCCCAGG + Intronic
1004720953 6:18266677-18266699 GGACGGCTGCAGCTGTGCCCAGG + Intergenic
1005021571 6:21423708-21423730 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1005043563 6:21620768-21620790 GGGCAGCTGCAGCAGCACCCTGG + Intergenic
1005775725 6:29129519-29129541 GAGCAGCTGCAGCTGCACCCGGG - Intergenic
1005781827 6:29201120-29201142 GGGCATCTGCAGCTGCGCCCAGG - Intergenic
1005790490 6:29295485-29295507 GGGTGGCTGCAGCCGCGCCCAGG - Intergenic
1005808782 6:29500648-29500670 TGGTCTCTGCAGCTGAGCCCAGG - Intergenic
1006347887 6:33498016-33498038 GGGCAGCTGCAGCTGCAACCAGG - Intergenic
1006359661 6:33580084-33580106 GGCTGGCGGCTGCTGCTCCCAGG + Exonic
1006380295 6:33693336-33693358 GGAGGGCTGCAGCTGCGGCAGGG + Intronic
1006467202 6:34202846-34202868 AGGTGGCTGCAGTTGCACCTGGG + Intergenic
1006467229 6:34202968-34202990 AGGTGGTTGCAGCTGCACCCAGG + Intergenic
1006478321 6:34272437-34272459 GGGAGGCTGGAGCTGGGGCCAGG + Intergenic
1006500805 6:34457805-34457827 AGGGGGCTGCAGCTGCACCCAGG - Intergenic
1006634560 6:35452598-35452620 GGGGGCCTCCAGCTGCGCCCAGG - Exonic
1006950811 6:37819889-37819911 CGGTGGCGGCGGCTGGGCCCGGG - Exonic
1007090728 6:39183215-39183237 GAGTGGCTGGAGCTGCAGCCAGG + Intergenic
1007165346 6:39824992-39825014 GGGTGGCTTCAGAGGGGCCCAGG + Intronic
1007728828 6:43933336-43933358 TGATGTCTGCAGCTGCTCCCAGG + Intergenic
1008330755 6:50241198-50241220 GGGCGGCTGCAGCTGCACCCGGG + Intergenic
1009530324 6:64803953-64803975 GGGTGGCTGCAGCTGCGCCCGGG + Intronic
1009534411 6:64861470-64861492 GGGTGGCTGCAGGTGTACCTGGG + Intronic
1009582879 6:65558506-65558528 GGGTGGCTGCCGCTGCACCTGGG + Intronic
1009588528 6:65637524-65637546 GGGTGGCTGCAGCTGTGCCAGGG - Intronic
1009610259 6:65931490-65931512 GGGTGGCTATAGCTACACCCAGG + Intergenic
1009643205 6:66363246-66363268 GGGTAGCTGTGGCTGTGCCCAGG + Intergenic
1009871088 6:69452484-69452506 GGGTGGCTACAGCTGTGCCCAGG + Intergenic
1010519603 6:76817528-76817550 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
1010883885 6:81214608-81214630 GGGTGGCTGCAGTGGCGCCTGGG - Intergenic
1010883927 6:81214780-81214802 GGTTGGCTGCAGCTGCACCTGGG - Intergenic
1010883951 6:81214899-81214921 GGGCGGCTACAGCTGCACCTGGG - Intergenic
1011822722 6:91271930-91271952 GGGTGGCTGAACCTGCGCCTGGG + Intergenic
1012052406 6:94361831-94361853 GGGCATCTGCAGCTGCACCCAGG + Intergenic
1012100726 6:95083567-95083589 GGGTAGCTGCAGCTTTGCCCAGG - Intergenic
1012122251 6:95383908-95383930 GGGTGGCTGCAGCTATGCCCAGG - Intergenic
1012122278 6:95384002-95384024 GGGTGCCTACAGCTGCACCTGGG - Intergenic
1012169653 6:96002395-96002417 GGATGGCTGCAGCTGTTCCTGGG + Intergenic
1012449313 6:99338472-99338494 TGGTGGCTGCAGCAGCTGCCAGG - Intronic
1012752680 6:103183805-103183827 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1012889830 6:104885556-104885578 GGCTGGTTGCAGCAGTGCCCAGG - Intergenic
1013236185 6:108199249-108199271 GGGTGGCTGTAGCCCCGCCCAGG + Intergenic
1013709447 6:112880051-112880073 TGGCCGCTGCAGCTGCACCCAGG + Intergenic
1013709480 6:112880173-112880195 GGGTGGCTGCAACTGCACCAGGG + Intergenic
1013709522 6:112880361-112880383 GGGCGGCTGCAGTGGCACCCGGG + Intergenic
1014227263 6:118862230-118862252 GGGTGGCTGTAGCTTCACCTGGG + Intronic
1014289215 6:119539443-119539465 GGGAGGCTGCAGTTGTGCTCTGG - Intergenic
1014391568 6:120871969-120871991 GGGTGGCTGCAGCTGTGCCCGGG - Intergenic
1014418764 6:121215325-121215347 GAGTGCCTGCAGCTGTGCCTGGG + Intronic
1014505434 6:122248470-122248492 GGCCAGCTGCAGCTGCGCCCAGG + Intergenic
1014770374 6:125452953-125452975 GGGTGGCTGCAGCTGTGTCTGGG - Intergenic
1015455772 6:133424720-133424742 AGGTGGCTGCAGCTGCACCCAGG + Intronic
1015663597 6:135603132-135603154 GAGTGGCTGCAGCTATGCCCAGG - Intergenic
1016076865 6:139805601-139805623 GGGTGACTGCAGCTGTGCCCAGG + Intergenic
1016339784 6:143049946-143049968 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1016923324 6:149317402-149317424 CGGCGGCTGCGGCTGCGGCCCGG - Intronic
1017054347 6:150424296-150424318 GGGTGGCTGCAGCAGCACCCAGG - Intergenic
1017054371 6:150424389-150424411 GGGTAACTGCAGCTGCGCCTGGG - Intergenic
1017420599 6:154268357-154268379 GGGTAGCTGCAGCAGCACCCAGG + Intronic
1017577287 6:155818892-155818914 GGGTGGCTGCTGGTGCGGCGTGG - Intergenic
1017992646 6:159504757-159504779 TGGTGGCAGCAGCAGCGCCTGGG - Intergenic
1018065085 6:160118974-160118996 AGGTGGTTGCAGCTGCATCCAGG + Intergenic
1018660020 6:166077076-166077098 GGGTGGCTGCCGCTGCACCCAGG + Intergenic
1018903077 6:168060784-168060806 GGGTGGCTGCGGCTGGTCCTGGG + Exonic
1018920401 6:168168359-168168381 CGGTGGCTGCAGCGTGGCCCTGG + Intergenic
1019296190 7:276623-276645 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
1019296233 7:276796-276818 GGGTGGCTGTAGCCCCACCCAGG + Intergenic
1019412852 7:914175-914197 GAGTGGCTGCAGGTCTGCCCTGG - Intronic
1019531204 7:1504339-1504361 GGGTGGCGGCGGCGGCGCTCCGG - Exonic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019740499 7:2670565-2670587 GGGGCGCTGCAGCTGGGCACGGG + Intergenic
1019812385 7:3174321-3174343 GGGGGGCTGCAGCCGGGTCCTGG - Intronic
1019889274 7:3932999-3933021 CGGTGGCACCAGCTGCCCCCAGG - Intronic
1020032078 7:4940373-4940395 GGGTGGCTGCAGCCGCGTTCCGG - Intronic
1020178099 7:5898798-5898820 GGATGGCTGCAGCGGCGGCCGGG + Exonic
1020304828 7:6826177-6826199 GGATGGCTGCAGCGGCGGCCGGG - Exonic
1020322548 7:6950230-6950252 GGGTGGCAGCAGCTGCTTCACGG + Intergenic
1020445432 7:8262332-8262354 GGGAGGCAGCGGCGGCGCCCAGG - Intronic
1020568150 7:9822918-9822940 TGGTAGCTGCAGCCGCACCCAGG + Intergenic
1020812532 7:12864434-12864456 GGGAGGCTGCAGATGCACCTGGG + Intergenic
1021097147 7:16547475-16547497 GGGCAGCTGCAGCTGTGCCTAGG - Intronic
1021431247 7:20560697-20560719 GAGTGGCAGCAGCCGCGCCGGGG + Intergenic
1021561530 7:21972579-21972601 GGGTGGCTGTAGCCCCACCCAGG + Intergenic
1022742592 7:33137368-33137390 GGGTAGCTGCAGATGTGCCCAGG + Intronic
1023203565 7:37724021-37724043 GGGTGGCAGCAGGGGTGCCCTGG + Intronic
1023700144 7:42883993-42884015 GAATGGCTGCAGCTGTGTCCAGG + Intergenic
1023700170 7:42884083-42884105 GGGCGGCTGCAGCTGTACCCAGG + Intergenic
1023788998 7:43737296-43737318 GGGTGGCTGTAGCTCTGCCCAGG - Intergenic
1023789017 7:43737387-43737409 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1023790571 7:43750110-43750132 GGAAGGCTGCATCTGCACCCGGG + Intergenic
1023790593 7:43750202-43750224 GGGTGGCTGCAGCCCCACCCAGG + Intergenic
1024024448 7:45399275-45399297 GGGTAGCTGCAGTTGCTCCCGGG - Intergenic
1024065213 7:45726908-45726930 GGGGGCCCGCAGCTGAGCCCCGG + Intergenic
1024254681 7:47531891-47531913 TGGTGGCTGCAGCTGCACCCCGG - Intronic
1024785030 7:52897895-52897917 GGGTGGCTGGGGCTGGGCCAGGG - Intergenic
1024857139 7:53794961-53794983 GGGTGGAGGCAGCTGCACCTGGG + Intergenic
1025288088 7:57685242-57685264 GGGCAGCTGCAGCGGCACCCAGG - Intergenic
1026359700 7:69591816-69591838 AGGCGGCTGCAGCTGCTCCTAGG + Intergenic
1026359732 7:69591941-69591963 CGGCGGCTGCAGCTGCACCCGGG + Intergenic
1026370285 7:69691688-69691710 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
1026949593 7:74338488-74338510 CGGGGGCAGCAGCTGCGGCCGGG - Exonic
1027128264 7:75572751-75572773 GGGTGGCTGCAGCTGCACCTGGG - Intronic
1027202318 7:76071912-76071934 GGGGGGCAGCAGCTGGGCCCTGG + Intergenic
1027202614 7:76073091-76073113 GGGGTGCAGCAGCTGGGCCCTGG + Intergenic
1027687489 7:81295321-81295343 GGGTTGCTGCAGCTGTGCAGAGG + Intergenic
1027735035 7:81920952-81920974 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1027779973 7:82508188-82508210 GGGCGGCTGCAGCTGCACCTGGG + Intergenic
1027780033 7:82508432-82508454 GAGTGGCTCCAGCGGCACCCAGG + Intergenic
1028107490 7:86897318-86897340 GGGTAGCTGCAGATGTGCACTGG - Intronic
1028111666 7:86949541-86949563 GGGTAGCTGCAGCTGTGCTCAGG - Intronic
1028136657 7:87230160-87230182 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1028378999 7:90176950-90176972 GGGTGGCTGCAGCTGTACCTGGG + Intronic
1028402046 7:90434336-90434358 GGATGGATACAGCTGCACCCAGG + Intronic
1028596010 7:92546959-92546981 GGGCAGCGGCAGCTGTGCCCAGG - Intergenic
1028817001 7:95157465-95157487 GGGCAGCTGCAGCTGCACCCGGG + Intronic
1029080759 7:97972234-97972256 GGATGGCTGCAGCGGCGGCCGGG - Intergenic
1029327506 7:99822981-99823003 GGGTGGCTGCAGCAGCACCCAGG - Intergenic
1029350990 7:100012691-100012713 GGGTGGCTGCAGCTACTCCTGGG - Intergenic
1029899182 7:104021940-104021962 GGGCAGCTGCAGTTGTGCCCAGG - Intergenic
1029899196 7:104022014-104022036 GGGTGGCTGCAGCTGTGCTCAGG - Intergenic
1029973880 7:104814979-104815001 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1029973896 7:104815051-104815073 GGGTGGCTGCAGCTATGCCCAGG + Intronic
1030359357 7:108579370-108579392 GGGTGGCTGCAGGTGTGCCTGGG - Intergenic
1031248564 7:119350335-119350357 GGGTGGCTGCAGCTGCACCCAGG - Intergenic
1031743864 7:125468745-125468767 GAGTGGCTGCAGTTGCACCTGGG + Intergenic
1031836345 7:126685419-126685441 GAGCAGCTGCAGCTGCACCCAGG - Intronic
1031976162 7:128094939-128094961 GGGTGGATGCAGCAGAGCCCAGG + Intergenic
1032591304 7:133194359-133194381 GAGTGGCTACAGCTGCGCCTGGG + Intergenic
1032658429 7:133956004-133956026 GGGTGGCAGCAGCTGCACCTGGG + Intronic
1032858713 7:135858432-135858454 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
1033461566 7:141551433-141551455 TGGTGAGTGCAGCGGCGCCCAGG + Exonic
1033568454 7:142602495-142602517 TTGTGGCTGCAGCTGCTACCGGG + Intergenic
1033658062 7:143386614-143386636 GGGTGGCTGCAGGTGCCCGGAGG + Intronic
1034093123 7:148382227-148382249 GGGTGGCAGCAGAGGCTCCCGGG - Intronic
1034210506 7:149358624-149358646 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1034252296 7:149701967-149701989 GGGTGGCTGCACCTGTACCTGGG + Intergenic
1034327522 7:150250058-150250080 GGGTGGCTGGAGCTTCGCAGAGG + Intronic
1034393134 7:150801111-150801133 CTGTGCCAGCAGCTGCGCCCCGG - Exonic
1034412263 7:150947713-150947735 AGGGGGCTGGAGCTGCGGCCTGG + Exonic
1034481089 7:151320897-151320919 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1034547989 7:151801467-151801489 TGGTGCCTGCAGCTGGTCCCTGG - Intronic
1034765690 7:153719387-153719409 GGGTGGCTGGAGCTTCGCAGAGG - Intergenic
1034868194 7:154658568-154658590 GGGAGGCTCCAGCTTGGCCCAGG - Intronic
1034966302 7:155393301-155393323 GGGTGGCAGCAGCTGTCCCCAGG - Intronic
1035225741 7:157431181-157431203 GAGTGGTGGCAGCCGCGCCCCGG + Intergenic
1035652355 8:1277692-1277714 GGCTGGCAGCAGCTGCACCGAGG + Intergenic
1036373496 8:8180740-8180762 GGGTGGCAGCAGCTGCTGCACGG - Intergenic
1036562177 8:9906701-9906723 GGGAGGCTGCACCGGCGCTCAGG - Intergenic
1036877409 8:12484901-12484923 GGGTGGCAGCAGCTGCTGCACGG + Intergenic
1037150142 8:15626542-15626564 GGACAGTTGCAGCTGCGCCCAGG - Intronic
1037554051 8:20004741-20004763 GGGTGGCTGCAGCCATGCCCAGG + Intergenic
1037554070 8:20004836-20004858 TGATGGCTGCAGCTGCACCCAGG + Intergenic
1038158305 8:25012041-25012063 GTTGGGCTGCAGCTGAGCCCAGG - Intergenic
1038325747 8:26571484-26571506 GGGTGGCTACAGATGTTCCCTGG - Intronic
1039182424 8:34880920-34880942 GGGTGCCTGCAGTTGCAACCAGG + Intergenic
1039549012 8:38429938-38429960 TGGTGGCTGCAGCCCAGCCCTGG - Exonic
1039885814 8:41653574-41653596 GGTTGGCTGCAGCAGCGACCTGG + Intronic
1039955409 8:42203386-42203408 GGGTGTCTGCAGCAGCTGCCCGG - Intronic
1040568075 8:48584120-48584142 CGGTGGCTGCAGCTCCGCACAGG + Intergenic
1041383837 8:57278981-57279003 TGGCAGCTGCAGCTGAGCCCAGG - Intergenic
1041956292 8:63560315-63560337 GGGCAGCTGCAGCTGCATCCAGG + Intergenic
1042395935 8:68292422-68292444 GGGTGGCTGCAGCGTCACCCGGG - Intergenic
1042608905 8:70576806-70576828 GGGTGGCTGCCACTGTGCCCAGG - Intronic
1042624991 8:70748265-70748287 GGGCAGCTACATCTGCGCCCAGG - Intronic
1042856512 8:73273229-73273251 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1043082673 8:75785139-75785161 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1043087282 8:75849987-75850009 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
1043195423 8:77287024-77287046 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1043414655 8:80034305-80034327 GGGTGGCTGCAGCTGCACCCAGG + Intronic
1043533146 8:81172080-81172102 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1043695090 8:83207969-83207991 GGGTATCTGCAGCAGCACCCAGG - Intergenic
1043745477 8:83869186-83869208 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1043756157 8:84005987-84006009 GGGCAGCTGCAGCTGCGCCCGGG + Intergenic
1043798765 8:84579399-84579421 GGTCAGCTGCAGCTGTGCCCAGG + Intronic
1044008876 8:86967244-86967266 GGGTGGCTGAAGCCACACCCAGG + Intronic
1044242389 8:89902493-89902515 CGGCGGCTGCAGCGGCGCGCGGG - Intronic
1044259297 8:90098605-90098627 GGGTGGCCGCAGCCGCACCTGGG + Intergenic
1044775061 8:95678676-95678698 GAGTGGTTGCAGCTGCACCTGGG + Intergenic
1045180417 8:99775528-99775550 TGGTGGCTGCTGCTGTGCACGGG - Intronic
1045887938 8:107122556-107122578 GGGTGGCTGCAGCTACCCCTGGG - Intergenic
1046187119 8:110735211-110735233 GGGTGGCTGCAACTGCTCCCGGG + Intergenic
1046195626 8:110860068-110860090 GGGTGGCAGCAGCTGCACCCAGG - Intergenic
1046459805 8:114518409-114518431 GGGCAGCTGCAGCTGTGCTCAGG + Intergenic
1046503853 8:115111945-115111967 GGGTGGCTGCAGCCGCTCCCTGG + Intergenic
1046674779 8:117095112-117095134 AGGTGGCTGCAGCTGCGCCAGGG + Intronic
1047544049 8:125797954-125797976 GGGCAACTGCAGCTGTGCCCAGG + Intergenic
1048238435 8:132716087-132716109 GAGCGGCTGCAGCTGCACCTGGG - Intronic
1048339226 8:133525931-133525953 AGGTAGCTGCAGCTGTGCCTGGG + Intronic
1048919616 8:139215996-139216018 GGGTGAAGGCAGCTGGGCCCAGG - Intergenic
1049168222 8:141140307-141140329 GGGTAGCTCCAGCTCCTCCCGGG + Intronic
1049341282 8:142113895-142113917 TGGTGGCAGCAGGTGTGCCCTGG - Intergenic
1049403343 8:142440676-142440698 GGGAGGATGGAGCTGGGCCCGGG - Intergenic
1049586939 8:143436640-143436662 GGGTGGGTCCAGCTGCGCACCGG + Intergenic
1049621956 8:143602452-143602474 TGGTGGCTGTAGCGGCCCCCAGG + Exonic
1049694312 8:143976159-143976181 GGGCCGCTGGAGCTGCGGCCCGG - Intronic
1049696472 8:143986481-143986503 GGGAGGGAGCAGCTGGGCCCTGG + Intronic
1049816298 8:144604192-144604214 GGGAGGCAGCAGCTGCACCTCGG + Intronic
1049823889 8:144654764-144654786 GGGTGGCTGCAGCACCACCCAGG - Intergenic
1049826954 8:144675027-144675049 AGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1050130385 9:2406414-2406436 GGGTGGCTGCAGCGGCCCCAGGG - Intergenic
1050483877 9:6114201-6114223 GGGTGGCTGCAACTGTGACTGGG - Intergenic
1050589808 9:7149435-7149457 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1050808788 9:9718501-9718523 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1050937153 9:11413342-11413364 AGGCAACTGCAGCTGCGCCCAGG - Intergenic
1051029748 9:12659079-12659101 GGGTGGCTGCATCTGTGCCGGGG + Intergenic
1051355067 9:16233690-16233712 GGGTGGCTGCAGCTACACCTGGG - Intronic
1052652502 9:31321886-31321908 GGGTGGTTGCAGCTGTGCCTGGG + Intergenic
1052707438 9:32010593-32010615 GGGAGGCTGCAGCTGTGCCCAGG - Intergenic
1052708048 9:32016586-32016608 AGGTGGCTGCAGCTGCACCTGGG + Intergenic
1053128044 9:35598898-35598920 GGGCGGCTGCAGCAGCACCCAGG - Intergenic
1053617278 9:39781393-39781415 GGGTGGCTGCAGCTGTACCCAGG - Intergenic
1053619245 9:39799014-39799036 GGGTGGCTGCAGCTGCACTTGGG + Intergenic
1053619265 9:39799104-39799126 GGGTGGCTGCAGTTGCACCTGGG + Intergenic
1053875461 9:42540756-42540778 GGGTGGCTGCAGCTGCACCCAGG - Intergenic
1053877401 9:42558363-42558385 GGGTGGCTGCAGCTGCACTTGGG + Intergenic
1053877420 9:42558453-42558475 GGGTGGCTGCAGCTGCACCTGGG + Intergenic
1053895241 9:42736235-42736257 GGGTGGCTGCAGTTGCGCCTGGG - Intergenic
1053897184 9:42753877-42753899 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054234275 9:62543269-62543291 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
1054234294 9:62543359-62543381 GGGTGGCTGCAGCTGCACTTGGG - Intergenic
1054236239 9:62560968-62560990 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
1054264892 9:62908325-62908347 GGGTGGCTGCAGTTGCACCTGGG - Intergenic
1054264912 9:62908415-62908437 GGGTGGCTGCAGCTGCACTTGGG - Intergenic
1054266888 9:62926044-62926066 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054550381 9:66595498-66595520 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054798627 9:69325384-69325406 CGGCGGCGGCAGCGGCGCCCGGG - Intronic
1055572517 9:77631937-77631959 GGGCGGCTGCTGCAGCACCCAGG - Intronic
1055645318 9:78357221-78357243 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
1055891009 9:81123131-81123153 CCGTGGCTGCAGCTGCATCCAGG + Intergenic
1056733991 9:89189374-89189396 GAGTGGCTGGAGCTGAGTCCTGG - Intergenic
1056836899 9:89962755-89962777 GGGTGGCTGCAGCTTCTATCGGG + Intergenic
1056986031 9:91364351-91364373 GGGTGGCTACAGCTGCCCTCGGG - Intergenic
1057124074 9:92602526-92602548 TGGTGCCAGCAGCTGCACCCAGG + Intronic
1057468419 9:95337195-95337217 GGGTGGCTGCAGCTGTGCCCTGG - Intergenic
1057548372 9:96034712-96034734 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1057758203 9:97853520-97853542 GGGTGGCTGCAGCTGGTCTGTGG - Exonic
1057902382 9:98959704-98959726 GGGTTGCTACAGCAGCTCCCTGG + Intronic
1058091785 9:100813874-100813896 GGGTGGCTGCAGCTGCACCCAGG + Intergenic
1058545910 9:106059989-106060011 AGGTGGCTGCTGCTGTGCCTGGG + Intergenic
1058590305 9:106558200-106558222 GCACGGCTGCAGCTGCGACCAGG - Intergenic
1058840990 9:108908919-108908941 GGGTGGCTGCAGCAGAGCAAAGG - Intronic
1059335220 9:113564861-113564883 GGGAGGCTGCAACTGAACCCAGG - Intronic
1059401115 9:114071148-114071170 GGGCGGCTGCTGCTGCACCTGGG - Intronic
1059565418 9:115379590-115379612 GGGTGGCTGTAGCCCCACCCAGG - Intronic
1059566240 9:115385590-115385612 GGGTGGCCGCAGCTGCGCCCAGG - Intronic
1060234518 9:121853167-121853189 GGGTTGCCGCGGCTGAGCCCTGG + Intronic
1060550499 9:124482686-124482708 GTGTGGCTGCGGCCCCGCCCAGG + Exonic
1060618729 9:125043919-125043941 GGGTAGCTGCAGCTGCACCCAGG - Intronic
1060967889 9:127721647-127721669 GGGAGGCTGCAGCCCAGCCCCGG - Intronic
1061259081 9:129469726-129469748 GGGTTGCTCCTGCTGTGCCCAGG + Intergenic
1061267222 9:129513960-129513982 GGGTGGCTGCGGCTGCATCCAGG - Intergenic
1061413685 9:130434040-130434062 GGGTGGCAGCAGCTGTCGCCCGG + Exonic
1061955807 9:133960778-133960800 GGGAGGCTGCAGCTCCTCTCTGG - Intronic
1061972641 9:134053245-134053267 GGGAGGCAGCAGCTACGCACCGG + Exonic
1062022765 9:134326956-134326978 GCGCGGCTGCAGCTGGGCGCCGG - Intronic
1062044362 9:134418217-134418239 GGGTGGCTCCAGCTGTGCCCGGG + Intronic
1062184624 9:135211426-135211448 GGGTAGCTGCAGCTCCACCGGGG - Intergenic
1062296029 9:135827469-135827491 GGGGGGCTGCAGCTCAGCCAGGG + Exonic
1062329024 9:136028678-136028700 GGGCAACTGCAGCTGCGCCTGGG - Intronic
1062373199 9:136250840-136250862 GGCTGGGTCCAGCTGCTCCCGGG + Intergenic
1062409655 9:136416859-136416881 GGCTGGCTGCAGATGGGCGCTGG + Intronic
1062444093 9:136586123-136586145 GGGAGGCAGCAGCTGTCCCCTGG - Intergenic
1062473017 9:136714479-136714501 GGGAGGCTGCAGCTGGCCTCGGG - Intronic
1062587391 9:137255436-137255458 GGGTGTCTGCGGCGGCGCCGGGG + Exonic
1062637572 9:137499678-137499700 GGGTGGGGGCAGCGGGGCCCTGG - Intronic
1062710422 9:137972334-137972356 GGGTGAGTGCAGCTGACCCCTGG - Intronic
1203691663 Un_GL000214v1:48068-48090 GGATGGCTGCAGCTGTGCCTGGG + Intergenic
1203751726 Un_GL000218v1:86738-86760 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1203710399 Un_KI270742v1:92706-92728 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1203540650 Un_KI270743v1:84746-84768 GGATGTCTGCAGCTGTGCCTGGG + Intergenic
1203612465 Un_KI270749v1:21769-21791 GGGCAGCTGCAGCAGCACCCAGG + Intergenic
1203644632 Un_KI270751v1:56123-56145 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1185867618 X:3637394-3637416 GGATGCCTGCAGCTGCTTCCAGG + Intronic
1185877510 X:3712931-3712953 GCGGGGCTGCACCTGCGCCCCGG - Intronic
1185894067 X:3843184-3843206 GCGGGGCTGCCCCTGCGCCCTGG - Intronic
1185899185 X:3881608-3881630 GCGGGGCTGCCCCTGCGCCCTGG - Intergenic
1185904302 X:3920037-3920059 GCGGGGCTGCCCCTGCGCCCTGG - Intergenic
1185935884 X:4257004-4257026 AGGCGGCTGCAGCTGCTCCCAGG - Intergenic
1186805735 X:13139028-13139050 GGGTGGCTGCAGCAGCACCCAGG - Intergenic
1186805756 X:13139109-13139131 GGGCAGATGCAGCTGCGCCTAGG - Intergenic
1188207648 X:27380328-27380350 GGGTGGCTGCCGCTGTACCTGGG - Intergenic
1188207672 X:27380419-27380441 GGGTGGCTGCAGCTGCATCTGGG - Intergenic
1188727882 X:33607445-33607467 GGGTGGCTACAGCTGCACCCAGG + Intergenic
1188859974 X:35244548-35244570 GGGCGGCTGCACCTGTGCCTGGG + Intergenic
1188888068 X:35574670-35574692 GGATGGCTGCAGCAGCTCCAAGG + Intergenic
1189023764 X:37370491-37370513 GGGTGGCTACAGCTGTGCCCTGG - Intronic
1189023790 X:37370582-37370604 GGGCAGTTGCAGCTGCACCCAGG - Intronic
1189083491 X:37997379-37997401 GGATGGCTGCAGCTGTGTCCAGG - Intronic
1189856470 X:45229486-45229508 GGGTGGCTGTAGCTGCACACAGG + Intergenic
1189856487 X:45229567-45229589 GGGTGGTTGCAGCTGCACTCAGG + Intergenic
1189856541 X:45229813-45229835 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1189856566 X:45229902-45229924 GGGTGGCTGCAGTGGCACTCTGG + Intergenic
1190105936 X:47561334-47561356 GGATGGCTGCGCCTGGGCCCCGG + Intronic
1190369398 X:49726862-49726884 GGGCAGCTGCAGCTGCACCAGGG - Intergenic
1190444946 X:50514951-50514973 GGAAAGCTGCAGCTGCGCCTGGG + Intergenic
1190620799 X:52285013-52285035 GGCAGGCTGCAGCTGCACCTGGG + Intergenic
1190681589 X:52830995-52831017 GGGCAGCTGCAGGTGCACCCAGG - Intergenic
1190681618 X:52831132-52831154 GCTTGGCTGCAGCTGCACCCAGG - Intergenic
1190736146 X:53256867-53256889 GCGTGGCAGGAGCTGGGCCCCGG + Intronic
1190998670 X:55637035-55637057 GGGTGGCTGCAGGGGCACCCAGG - Intergenic
1190998689 X:55637116-55637138 CAGTGGCTACAGCTGCACCCAGG - Intergenic
1192265426 X:69534158-69534180 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1192267107 X:69546591-69546613 CAGTGGCTGCAGCTGCTCCAGGG - Intergenic
1192762211 X:74105330-74105352 CGGTGGCTGCAGCAGCGACTCGG + Intergenic
1193108610 X:77705066-77705088 GGGTGGCTGCGGCTGCACCCGGG + Intronic
1193108628 X:77705156-77705178 GGGAGACTGCAGCTGCACCCGGG + Intronic
1193468843 X:81875894-81875916 GGGTGGCCACAGCTGTACCCAGG + Intergenic
1193554048 X:82932113-82932135 GGGTGGCTGCAGCTGCACCTGGG - Intergenic
1193919458 X:87407269-87407291 GGGTGGCTGTAGCCCCGCCCAGG + Intergenic
1194205148 X:91002982-91003004 GGGCGGCCGCAGCTGCACCTGGG + Intergenic
1194205193 X:91003198-91003220 GGGTAGGTGCAGCCCCGCCCGGG + Intergenic
1194379254 X:93174690-93174712 AGGTGGTTGCAGCTGCACCCAGG - Intergenic
1194379278 X:93174813-93174835 GAGTGGCTGCAGCTGCATCCAGG - Intergenic
1194380147 X:93181243-93181265 GGGTGGCTGCAGTGGCACCCAGG - Intergenic
1194380181 X:93181405-93181427 AGGTGGGTGCAGCTTCACCCAGG - Intergenic
1194412973 X:93578569-93578591 GGGTGGCTGCAGCTGCACTCAGG - Intergenic
1195126393 X:101813353-101813375 GTTTGGTTGCAGCTGTGCCCTGG - Intergenic
1195179192 X:102339983-102340005 GGGTGGCTGCAGCTGTGCTCTGG + Intergenic
1195179217 X:102340072-102340094 GGGTGGCTGCAGGGGCACACAGG + Intergenic
1195454347 X:105051351-105051373 GGGCAGCCGCAGCTGCACCCAGG + Intronic
1195454390 X:105051548-105051570 GGGTGGCCGTAGCCCCGCCCAGG + Intronic
1195880404 X:109586794-109586816 GGGAGGCTGCAGATGTGCCTGGG + Intergenic
1197342102 X:125287122-125287144 GTGTGGCTGCAGCTGCACCAGGG - Intergenic
1197378273 X:125709279-125709301 GAGTGGCAGCATCTGCACCCGGG - Intergenic
1197421152 X:126238028-126238050 GGATGGCTGCAGCTATGCCTGGG - Intergenic
1197609651 X:128623693-128623715 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1197609674 X:128623783-128623805 GGGTGGCTGCAGCTGTGCCTAGG + Intergenic
1197796102 X:130299852-130299874 GCATGGCTGCAGCTGCATCCAGG + Intergenic
1197831817 X:130651139-130651161 GGGTGGCTGCAGGTCAGCTCAGG + Intronic
1198302418 X:135344928-135344950 GGGTGATTCCAGCTGTGCCCCGG + Intronic
1199092226 X:143705533-143705555 GGATGGCTACAGCTGCACCCAGG - Intergenic
1199188094 X:144939872-144939894 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1199188114 X:144939963-144939985 GGGTGCCTGCAGCTGTGCCCAGG + Intergenic
1199188444 X:144942314-144942336 ATGCGGCTGCAGCTGTGCCCAGG + Intergenic
1199559378 X:149146862-149146884 GGGTGGCTACAGCTGCACCCGGG - Intergenic
1199614615 X:149647123-149647145 GGGTGGCTGTGGCTGCACCCGGG - Intergenic
1199614633 X:149647204-149647226 GGGTAGCTGCAGCTGCACCCAGG - Intergenic
1199614648 X:149647285-149647307 GGGTGGCTGCAGCTGCACCCAGG - Intergenic
1199614671 X:149647371-149647393 GGGCGGTTGCAGCTGTGCCCAGG - Intergenic
1199861207 X:151801636-151801658 GGGTAGCTGCAGCTCCACCCAGG + Intergenic
1200066953 X:153508536-153508558 GGTTGGACGCAGCTGGGCCCTGG - Exonic
1200550967 Y:4578103-4578125 GGGCGGCCGCAGCTGCACCTGGG + Intergenic
1200551011 Y:4578319-4578341 GGGTAGGTGCAGCCCCGCCCAGG + Intergenic
1201165382 Y:11204358-11204380 GGATGGCTGCAGCTGTGCCTGGG - Intergenic
1201720285 Y:17089496-17089518 GGGTAGATGCGGCTGTGCCCAGG - Intergenic
1202073589 Y:21016822-21016844 GGACAGCTGCAGCTGTGCCCAGG + Intergenic
1202078289 Y:21058676-21058698 GGACAGCTGCAGCTGTGCCCAGG + Intergenic