ID: 987816093

View in Genome Browser
Species Human (GRCh38)
Location 5:22902166-22902188
Sequence CTGCAGCTGCGCCCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816079_987816093 30 Left 987816079 5:22902113-22902135 CCCAGGCCCCTGAGTGCCCAGGA No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816087_987816093 13 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816081_987816093 24 Left 987816081 5:22902119-22902141 CCCCTGAGTGCCCAGGAATGTCT No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816083_987816093 22 Left 987816083 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816082_987816093 23 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816086_987816093 14 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816091_987816093 -3 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data
987816080_987816093 29 Left 987816080 5:22902114-22902136 CCAGGCCCCTGAGTGCCCAGGAA No data
Right 987816093 5:22902166-22902188 CTGCAGCTGCGCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987816093 Original CRISPR CTGCAGCTGCGCCCAGGAGC AGG Intergenic
No off target data available for this crispr