ID: 987816096

View in Genome Browser
Species Human (GRCh38)
Location 5:22902169-22902191
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987816083_987816096 25 Left 987816083 5:22902121-22902143 CCTGAGTGCCCAGGAATGTCTGG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816086_987816096 17 Left 987816086 5:22902129-22902151 CCCAGGAATGTCTGGGTCCAGAG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816081_987816096 27 Left 987816081 5:22902119-22902141 CCCCTGAGTGCCCAGGAATGTCT No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816082_987816096 26 Left 987816082 5:22902120-22902142 CCCTGAGTGCCCAGGAATGTCTG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816087_987816096 16 Left 987816087 5:22902130-22902152 CCAGGAATGTCTGGGTCCAGAGC No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data
987816091_987816096 0 Left 987816091 5:22902146-22902168 CCAGAGCTGCAGCTGGGTGGCTG No data
Right 987816096 5:22902169-22902191 CAGCTGCGCCCAGGAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr