ID: 987817981

View in Genome Browser
Species Human (GRCh38)
Location 5:22928975-22928997
Sequence GCCTAGGCATGCCACAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987817974_987817981 23 Left 987817974 5:22928929-22928951 CCCTTCCCTTTTCTTCTCTTTTT 0: 2
1: 17
2: 146
3: 1451
4: 9502
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817973_987817981 24 Left 987817973 5:22928928-22928950 CCCCTTCCCTTTTCTTCTCTTTT 0: 2
1: 2
2: 110
3: 912
4: 5687
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817976_987817981 18 Left 987817976 5:22928934-22928956 CCCTTTTCTTCTCTTTTTCTTTC 0: 3
1: 20
2: 239
3: 2163
4: 11649
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817971_987817981 28 Left 987817971 5:22928924-22928946 CCCTCCCCTTCCCTTTTCTTCTC 0: 3
1: 19
2: 154
3: 1322
4: 7477
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817970_987817981 29 Left 987817970 5:22928923-22928945 CCCCTCCCCTTCCCTTTTCTTCT 0: 2
1: 23
2: 155
3: 997
4: 5342
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817977_987817981 17 Left 987817977 5:22928935-22928957 CCTTTTCTTCTCTTTTTCTTTCT 0: 2
1: 39
2: 352
3: 2848
4: 15434
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817972_987817981 27 Left 987817972 5:22928925-22928947 CCTCCCCTTCCCTTTTCTTCTCT 0: 3
1: 11
2: 112
3: 909
4: 6560
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data
987817975_987817981 22 Left 987817975 5:22928930-22928952 CCTTCCCTTTTCTTCTCTTTTTC 0: 2
1: 4
2: 104
3: 827
4: 5838
Right 987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987817981 Original CRISPR GCCTAGGCATGCCACAGCAC TGG Intergenic
No off target data available for this crispr