ID: 987831294

View in Genome Browser
Species Human (GRCh38)
Location 5:23099104-23099126
Sequence TGGCTTGTTCCCAATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987831294_987831298 30 Left 987831294 5:23099104-23099126 CCATAAAAATTGGGAACAAGCCA No data
Right 987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG No data
987831294_987831297 29 Left 987831294 5:23099104-23099126 CCATAAAAATTGGGAACAAGCCA No data
Right 987831297 5:23099156-23099178 ATACATCATATGTTACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987831294 Original CRISPR TGGCTTGTTCCCAATTTTTA TGG (reversed) Intergenic
No off target data available for this crispr